![EBK CONCEPTS OF GENETICS](https://www.bartleby.com/isbn_cover_images/9780134818979/9780134818979_largeCoverImage.gif)
EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13, Problem 24PDQ
Describe the role of two forms of RNA editing that lead to changes in the size and sequence of pre-mRNAs. Briefly describe several examples of each form of editing, including their impact on respective protein products.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
What is a functional consequence of RNA editing?
Consider the following sequence fragment of an mRNA. Which of the miRNAS below would be competent for gene silencing?
5'-AUGCAAGCAUUGGCCAAGCUU-3'
5'-AUGCAAGCAUUGGCCAAGCUU-3
5'-UACGUUCGUAACCGGUUCGAA-3'
5'-AAGCUUGGUUAAUGCUUGCAU-3'
5'-UUCGAACCAAUUACGAACGUA-3'
3'-UUCGAACCAAUUACGAACGUA-5
3'-AUGCAAGCAUUGGCCAAGCUU-5'
b) In eukaryotes, the newly synthesized MRNA undergoes modifications before it is
transported across the nuclear membrane into the cytoplasm. Outline any two of the
three modifications.
Chapter 13 Solutions
EBK CONCEPTS OF GENETICS
Ch. 13 - In a mixed heteropolymer experiment using...Ch. 13 - When repeating copolymers are used to form...Ch. 13 - The following represent deoxyribonucleotide...Ch. 13 - Prob. 1CSCh. 13 - A 30-year-old woman was undergoing therapy for...Ch. 13 - A 30-year-old woman was undergoing therapy for...Ch. 13 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 13 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 13 - Assuming the genetic code is a triplet, what...Ch. 13 - The mRNA formed from the repeating tetranucleotide...
Ch. 13 - In studies using repeating copolymers, AC ......Ch. 13 - In a coding experiment using repeating copolymers...Ch. 13 - Prob. 7PDQCh. 13 - When the amino acid sequences of insulin isolated...Ch. 13 - Prob. 9PDQCh. 13 - Why doesnt polynucleotide phosphorylase (Ochoas...Ch. 13 - Refer to Table 13.1. Can you hypothesize why a...Ch. 13 - Predict the amino acid sequence produced during...Ch. 13 - A short RNA molecule was isolated that...Ch. 13 - A glycine residue is in position 210 of the...Ch. 13 - Refer to Figure 13.7 to respond to the following:...Ch. 13 - Most proteins have more leucine than histidine...Ch. 13 - Define the process of transcription. Where does...Ch. 13 - Prob. 18PDQCh. 13 - Describe the structure of RNA polymerase in...Ch. 13 - Prob. 20PDQCh. 13 - Messenger RNA molecules are very difficult to...Ch. 13 - Present an overview of various forms of...Ch. 13 - One form of posttranscriptional modification of...Ch. 13 - Describe the role of two forms of RNA editing that...Ch. 13 - Substitution RNA editing is known to involve...Ch. 13 - Prob. 26ESPCh. 13 - Prob. 27ESPCh. 13 - Prob. 28ESPCh. 13 - Shown here are the amino acid sequences of the...Ch. 13 - The genetic code is degenerate. Amino acids are...Ch. 13 - M. Klemke et al. (2001) discovered an interesting...Ch. 13 - Recent observations indicate that alternative...Ch. 13 - Isoginkgetin is a cell-permeable chemical isolated...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe three (3) ways in which the primary transcript is modified as it is converted to mRNA.arrow_forwardIf an antisense RNA is designed to silence the following mRNA sequence, which of the following antisense oligos (a-d) could be used for this purpose? mRNA sequence: 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' AUCCUGAUAAUUCCAUGUAAAUAA 3' O 5' AAUGGGUGUACCUUAAUAGUCCUA 3' O 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' UUACCCACAUGGAAUUAUCAGGAU 3¹arrow_forwardOnce a primary RNA transcript is created from a DNA template, it must be modified in several ways before becoming messenger RNA (mRNA), ribosomal RNA (rRNA) or transfer RNA (TRNA). The following image shows RNA processing of one pre-mRNA into mRNA. Note that pre-RNA is processed in three ways: 1) a 5' methylguanylate cap (G cap) is added, 2) a poly-A tail is added, and 3) the spliceosome removes introns from the pre-mRNA transcript. Please redraw the following diagram and label the following on your diagram: DNA Promoter pre-mRNA (unprocessed) mRNA *5' methylguanylate cap *polyadenylation *Exon (may be more than one) *Intron (may be more than one) Transcription RNA processing AAAAA PART C: FOLLOW-UP QUESTIONS 1. Why is a poly-A tail important?: 2. What do introns do? Why do they exist in eukaryotes when they are mostly absent in prokaryotes? 3. What do you think 'alternative splicing' means, and how might it expand the function of a gene?arrow_forward
- What is mean by RNA editing ?arrow_forwardOnce a primary RNA transcript is created from a DNA template, it must be modified in several ways before becoming messenger RNA (mRNA), ribosomal RNA (rRNA) or transfer RNA (tRNA). The following image shows RNA processing of one pre-mRNA into mRNA. Note that pre-RNA is processed in three ways: 1) a 5' methylguanylate cap (G cap) is added, 2) a poly-A tail is added, and 3) the spliceosome removes introns from the pre-mRNA transcript. Please redraw the following diagram and label the following on your diagram: DNA Promoter pre-mRNA (unprocessed) mRNA *5' methylguanylate cap *polyadenylation *Exon (may be more than one) *Intron (may be more than one) Transcription RNA processing AAAAAarrow_forwardFor a specific type of mutation at a given location in a particular gene, identify whether it will affect the size of the mRNA, the protein, or both. How would the mutant appear on a gel in comparison to the originalarrow_forward
- RNA silencing can be accomplished by specific MRNA degradation or by preventing its translation of the encoded protein. What specifically determines which of these two pathways will be followed? OIt depends on whether Drosha is involved in the process. It depends on whether Dicer is associated with single- or double-stranded RNA. It depends on whether the single-stranded RNA, associated with RISC, base-pairs perfectly or imperfectly with the target mRNA. It depends on whether the RITS or the RISC complex associates with double-stranded RNA. It depends on whether RISC initially binds to single- or double-stranded RNA. OOOarrow_forwardBriefly, describe one mode of post-translational modification that occurs once translation is finished.arrow_forwardConsider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?arrow_forward
- List several ways in which RNA is processed after transcription.arrow_forwardIntrons are often very large and the cell has devoted mechanisms of eliminating them once they are excised from the pre-mRNA. Following intron excision, what specific ribonucleolytic enzymes or complexes contribute to eliminating the intron RNA immediately after it is excised from the pre-mRNA? Briefly describe the role of each step/enzyme and how it affects its RNA substratearrow_forwardA normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license