EBK CONCEPTS OF GENETICS
EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 13, Problem 29ESP

Shown here are the amino acid sequences of the wild-type and three mutant forms of a short protein.

Chapter 13, Problem 29ESP, Shown here are the amino acid sequences of the wild-type and three mutant forms of a short protein.

Use this information to answer the following questions:

  1. (a) Using Figure 13.7, predict the type of mutation that led to each altered protein.
  2. (b) For each mutant protein, determine the specific ribonucleotide change that led to its synthesis.
  3. (c) The wild-type RNA consists of nine triplets. What is the role of the ninth triplet?
  4. (d) Of the first eight wild-type triplets, which, if any, can you determine specifically from an analysis of the mutant proteins? In each case, explain why or why not.
  5. (e) Another mutation (mutant 4) is isolated. Its amino acid sequence is unchanged from wild type, but the mutant cells produce abnormally low amounts of the wild-type proteins. As specifically as you can, predict where this mutation exists in the gene.
Blurred answer
Students have asked these similar questions
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein.    Wild Type DNA Sequence:  3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence:    3' - AGTCTCGCCTGT - 5'
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…

Chapter 13 Solutions

EBK CONCEPTS OF GENETICS

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY