![EBK CONCEPTS OF GENETICS](https://www.bartleby.com/isbn_cover_images/9780134818979/9780134818979_largeCoverImage.gif)
Concept explainers
(a)
To determine: The evidence that supports the doublet code notion.
Introduction: The mRNA consists of many bases. A collection of three bases that has the capability to code for a particular amino acid is called codon. Codons are present in the mRNA. These codons attach with the anticodon part of tRNA to synthesize amino acid. The anticodon part of tRNA is complementary to the codon part of mRNA.
(b)
To determine: The ways by which “early” amino acids are important in terms of the evolution of genetic code.
Introduction: Transcription is the process by which DNA converts into pre-mRNA. The pre-mRNA undergoes post-transcriptional changes and converts into a mature mRNA. The next step after post-transcriptional changes is translation. It is the process by which the mRNA converts into amino acids. The collection of three bases present on the mRNA that codes for a specific protein is called codon. The amino acids join together by polypeptide bond to form protein molecules.
(c)
To determine: Whether the fact that “cysteine, tyrosine, and phenylalanine have only two codons” is a coincidence.
Introduction: A codon can code only for a single amino acid, but an amino acid can be coded by more than one codon. For example, GCU codes for alanine only, but alanine can be coded by GCU, GCC, GCA, and GCG codons.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 13 Solutions
EBK CONCEPTS OF GENETICS
- a) Examine the nucleotide sequence below, and determine the amino acid sequence encoded by this mRNA. (2) 5' CCUCCGGACCGGAUGCCCGCGGCAGCUGCUGAACCAUGGCCCGCGGGUGAGCCAAGGAGGAGGGC 3' b) What would be the consequence of a mutation that resulted in changing the underlined nucleotide to a G? (2) Second base U G. Consensus sequences functioning in transcription or translation (5-3): UGU UAU UCU Phe UCC Ser UCA Leu UCG UUU Tyr Cys TATA box (-25) TATAAA UUC UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUA TFIIB recognition element /c/c/¢CGCC UUG TATAAT CGU CAU His CAC Pro CAA Gln CAG -10 (Pribnow) sequence CUU CCU CC Leu CCA CGC Arg CGA CUC TTGACA -35 sequence CỦA CUG CCG CGG Shine-Dalgarno sequence (Ribosome binding site) UAAGGAGGU YYANT/AYY AGU Asn AGC AUU ACU AAU Ser Initiator element AUC lle ACC Thr AAC AGA Lys AGG AUA ACA AAA lA AGLGU ^/G AGU Arg Intron 5' splice site AUG Met ACG AAG CAGIG GGU GAU Asp GAC Intron 3' splice site GCU GUU GCC Val GCA GGC Gly GGA GUC AAUAAA Ala Cleavage site…arrow_forward(a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?arrow_forwardOne remarkable feature of the genetic code is that amino acids with similar chemical properties often have similar codons. thus codons with U or C as the second nucleotide tend to specify hydrophobic amino acids. Can you suggest a possible explanation for this phenomenon in terms of the early evolution of the protein-synthesis machinery?arrow_forward
- Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forwardGene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…arrow_forwardStructural analysis of bacterial release factor 1 (RF-1) and release factor 2 (RF-2) reveals that these proteins are similar in size and shape to a tRNA molecule. This similarity has sometimes been called molecular mimicry. Why might RF-1 and RF-2 have evolved to mimic tRNAs?arrow_forward
- Sickle cell disease is caused by a so-called “point mutation" in the human B-globin gene. A point mutation is the result of a single base substitution in the DNA encoding a gene. The sickle cell mutation results in substitution of Val for Glu at position 6 in the B-globin protein. (a) Using the information in Figure 5.18 explain how a point muta- tion could change a codon for Glu to a codon for Val. (b) Do you expect the pI for the sickle cell B-globin to be higher or lower than the pl for wild-type B-globin? Explain.arrow_forwardProteins called molecular chaperones assist in the process of protein folding. One class of chaperones found in organisms from bacteria to mammals is heat shock protein 90 (Hsp90). All Hsp90 chaperones contain a 10 amino acid “signature sequence” that allows ready identification of these proteins in sequence databases. Two representations of this signature sequence are shown below. (a) In this sequence, which amino acid residues are invariant (conserved across all species)?(b) At which position(s) are amino acids limited to those with positively charged side chains? For each position, which amino acid is more commonly found?(c) At which positions are substitutions restricted to amino acids with negatively charged side chains? For each position, which amino acid predominates?(d) There is one position that can be any amino acid, although one amino acid appears much more often than any other. What position is this, and which amino acid appears most often?arrow_forwardStructural analysis of bacterial release factor 1 (RF-1) and release factor-2 (RF-2) reveals that these proteins are similar in size and shape to a tRNA molecule. This similarity has sometimes been called molecular mimicry. Why might RF-1 and RF-2 have evolved to mimic tRNA?arrow_forward
- Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forwardConsider the following tRNAs, where the numbered forms represent the amino acids associated with them, answer briefly: PICTURE Question 1: The numbering indicates the order in which these tRNAs are recruited to the A site of the ribosome. Write the sequence of the mRNA being translated in the 5' - 3' direction Question 2: What is the amino acid sequence of the produced polypeptide? Question 3: Researchers discover that a mutation is in the anticodon of the gene encoding the proline tRNA of an individual. The anticodon sequence is normally 3' GGA 5', but in this individual the anticodon sequence is 3' GGG 5'. It appears that this individual suffers no adverse consequences. How can this be? (2 response items)arrow_forwardTwo eukaryotic proteins have one domain in common but areotherwise very different. Which of the following processes ismost likely to have contributed to this similarity?(A) gene duplication(B) alternative splicing(C) exon shuffling(D) random point mutationsarrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)