EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13, Problem 2PDQ
CONCEPT QUESTION Review the Chapter Concepts list on p. 283. These all center around how genetic information is stored in DNA and transferred to RNA prior to translation into proteins. Write a short essay that summarizes the key properties of the genetic code and the process by which RNA is transcribed on a DNA template.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
true or false
1.) The unique stem-loop structures of the transfer RNA helps the RNA perform its function of joining ribosomal proteins to form the sites for protein synthesis.
2.) DNA molecules can perform their function in replication and transcription as long as the 2 strands remain intact and not separated.
3.) Histone proteins are able to associate with DNA segments because of the anionic nature of the amino acids arg and lys.
4.) The long solenoid structure of the chromatin material binds to a protein scaffold and folds further to form the chromatin/chromosome structure.
5.) Primary amines and keto groups of the nitrogen bases are involved in base-pairing in double stranded DNA.
As we focused on the genetic code and the transcription of genetic information stored in DNA into complementary RNA molecules. Along the way, we found many opportunities to consider the methods and reasoning by which much of this information was acquired. From the explanations given in the chapter, what answers would you propose to the following fundamental questions:
Question: How do we know that the initial transcript of a eukaryotic gene contains noncoding sequences that must be removed before accurate translation into proteins can occur?
Please do answer all the questions. I'll definitely give a like
You discovered a halophilic bacterium and want to characterize the mechanism involved in producing mature tRNA molecules from larger tRNA precursors. You isolated a large complex composed of a protein component and an RNA component that is capable of cleaving the larger tRNA precursor. To determine which one of the two components is responsible for catalysis, you perform an in vitro tRNA cleavage assay in the proper buffer conditions, including a low concentration of Mg2+ and 0.5 M bovine serum albumin (BSA). BSA is not specific for this reaction. The table below summarizes the results after performing eight separate reactions. The + symbol indicates the included reaction components.
Q. Based on the results obtained, what can you conclude about the composition of the biological catalyst required for the maturation of tRNA?
Q. Indicate which reactions helped you make your conclusion. Why?
Q. Which reactions allowed you…
Chapter 13 Solutions
EBK CONCEPTS OF GENETICS
Ch. 13 - In a mixed heteropolymer experiment using...Ch. 13 - When repeating copolymers are used to form...Ch. 13 - The following represent deoxyribonucleotide...Ch. 13 - Prob. 1CSCh. 13 - A 30-year-old woman was undergoing therapy for...Ch. 13 - A 30-year-old woman was undergoing therapy for...Ch. 13 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 13 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 13 - Assuming the genetic code is a triplet, what...Ch. 13 - The mRNA formed from the repeating tetranucleotide...
Ch. 13 - In studies using repeating copolymers, AC ......Ch. 13 - In a coding experiment using repeating copolymers...Ch. 13 - Prob. 7PDQCh. 13 - When the amino acid sequences of insulin isolated...Ch. 13 - Prob. 9PDQCh. 13 - Why doesnt polynucleotide phosphorylase (Ochoas...Ch. 13 - Refer to Table 13.1. Can you hypothesize why a...Ch. 13 - Predict the amino acid sequence produced during...Ch. 13 - A short RNA molecule was isolated that...Ch. 13 - A glycine residue is in position 210 of the...Ch. 13 - Refer to Figure 13.7 to respond to the following:...Ch. 13 - Most proteins have more leucine than histidine...Ch. 13 - Define the process of transcription. Where does...Ch. 13 - Prob. 18PDQCh. 13 - Describe the structure of RNA polymerase in...Ch. 13 - Prob. 20PDQCh. 13 - Messenger RNA molecules are very difficult to...Ch. 13 - Present an overview of various forms of...Ch. 13 - One form of posttranscriptional modification of...Ch. 13 - Describe the role of two forms of RNA editing that...Ch. 13 - Substitution RNA editing is known to involve...Ch. 13 - Prob. 26ESPCh. 13 - Prob. 27ESPCh. 13 - Prob. 28ESPCh. 13 - Shown here are the amino acid sequences of the...Ch. 13 - The genetic code is degenerate. Amino acids are...Ch. 13 - M. Klemke et al. (2001) discovered an interesting...Ch. 13 - Recent observations indicate that alternative...Ch. 13 - Isoginkgetin is a cell-permeable chemical isolated...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Hand written solutions are strictly prohibited.arrow_forwardQuestion:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide 5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'arrow_forwardThe diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (iii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.arrow_forward
- 6a and 6barrow_forwardListed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.arrow_forward8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…arrow_forward
- Procedure 1. 2. 3. 4. 5. 6. Fill in the data table below. Complete column B by writing the correct mRNA codon for each sequence of DNA bases listed in the column marked DNA Base Sequence. Use the letters A, U, C, or G. Identify the process responsible by writing its name on the arrow in column A. Complete column D by writing the correct tRNA anticodon that bonds to each mRNA codon from column B. Identify the process responsible by writing its name on the arrow in column C. Translate the mRNA codons from column B into amino acids in column E using the table. Data Table DNA base sequence AAT GGG ATA AAA GTT A Process B mRNA codon с Process D tRNA |anticodon E Amino acidarrow_forwardB Relates to the ribosome codon question please do ii ribosome coding questionsarrow_forwardContrast transcription and translation. Name at least three differences between the two processes.arrow_forward
- The following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…arrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardCan you help me solve this sequence question and identifty the mutation?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license