![BIOLOGY-TEXT](https://compass-isbn-assets.s3.amazonaws.com/isbn_cover_images/9781260169621/9781260169621_smallCoverImage.jpg)
BIOLOGY-TEXT
5th Edition
ISBN: 9781260169621
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13.3, Problem 1CC
Effects of Non-coding RNAs on Translation and mRNA Degradation
Concept Check: Explain why RISC binds to a specific mRNA. What type of bonding occurs?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
List and briefly explain. C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA processing enzymes carry out their duties at the apporpiate time and place?
Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.
RNA transcription reach low error rate under non-equilibrium steady state, what is the energy source to drive transcription ?
Chapter 13 Solutions
BIOLOGY-TEXT
Ch. 13.1 - Prob. 1CCCh. 13.2 - Prob. 1CCCh. 13.3 - Prob. 1EQCh. 13.3 - Prob. 2EQCh. 13.3 - Prob. 3EQCh. 13.3 - Effects of Non-coding RNAs on Translation and mRNA...Ch. 13.4 - Non-coding RNAs and Protein Sorting Core Skill:...Ch. 13.5 - Core Skill: Modeling The goal of this modeling...Ch. 13 - Prob. 1TYCh. 13 - Prob. 2TY
Ch. 13 - Prob. 3TYCh. 13 - Prob. 4TYCh. 13 - Prob. 5TYCh. 13 - Prob. 6TYCh. 13 - With regard to miRNAs and siRNAs, which of the...Ch. 13 - Cas1 and Cas2 proteins play a role during which of...Ch. 13 - Which of the following components bind to...Ch. 13 - Abnormalities in the expression of ncRNAs are...Ch. 13 - An ncRNA may have one or more of the following...Ch. 13 - What is RNA interference (RNAi)? Explain how the...Ch. 13 - Prob. 3CQCh. 13 - Prob. 1COQCh. 13 - Go to the PubMed website and search for non-coding...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Recall from the central dogma that DNA codes for mRNA, which then codes for protein. Also recall that directionality matters! DNA 3' TAC - CTA -AAT - TGC - TCG-ATT 5' mRNA 5' ???- ???- ???- ???- ???- ??? 3' protein ? ? ? ? ? (A) Indicate whether the DNA sequence provided is the sense strand or the antisense strand. ? that (B) For the DNA sequence given above, write out the mRNA sequence that results. (C) Now write the amino acid sequence that results from the mRNA sequence you wrote in part (B). Use the three-letter abbreviations for the amino acids. (D) What happens if the A that is bolded and underlined in the given DNA sequence is mutated (changed) to a C? How is the protein affected? This can be answered in a few words, but be specific! (E) Now let's pretend for a moment that the protein being affected is ATP-ADP translocase. What, if anything, would happen to the citric acid cycle? This should be answered in a few words/one sentence max.arrow_forwardE32. In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects that region from digestion by DNase I by blocking the ability of DNase I to gain access to the DNA. In the DNase I footprinting experiment shown here, a researcher began with a sample of cloned DNA 400 bp in length. This DNA contained a eukaryotic promoter for RNA polymerase II. The assembly of general transcription factors and RNA polymerase II at the core promoter is described in Chapter 12 (see Figure 12.14). For the sample loaded in lane 1, no proteins were added. For the sample loaded in lane 2, the 400-bp fragment was mixed with RNA polymerase II plus TFIID and TFIIB. 2 400 350 250 175 50 Which region of this 400-bp fragment of DNA is bound by RNA polymerase II and TFIID and TFIIB? || III ||| | ||||arrow_forwardGenetics of man question:Describe the molecular genetics analysis for the GATA binding protein gene and consider the possibility of lethality and functional redundancy and experimental strategies to address possibilities.arrow_forward
- Part I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardInstructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.arrow_forward
- Learning activity 5 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what sequence of bases would appear in MRNA transcribed from this segment b.) assume that the first base in this MRNA is the beginning of a codon. What order of amino acids would be translated into a polypeptide synthesized along this segment? c.) give anticodons for each tRNA associated with the translation in part (b)arrow_forwardQ34. mRNA decay (breakdown) can play an important role in controlling protein abundance. Which of the following scenarios correctly describes a relationship between mRNA decay and protein abundance? A. A decrease in transcription with an increase in the rate of mRNA decay can result in increased protein abundance. B. An increase in transcription with an increase in the rate of mRNA decay can result in no change in protein abundance. C. An increase rate of protein synthesis but failure to form an apoprotein can be explained by a decrease in mRNA decay. D. None of the abovearrow_forwardTrue or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.arrow_forward
- Transcription AttenuationHow would transcriptionof the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA?(a) Increasing the distance (number of bases) betweenthe leader peptide gene and sequence 2(b) Increasing the distance between sequences 2 and 3(c) Removing sequence 4(d) Changing the two Trp codons in the leader peptidegene to His codons(e) Eliminating the ribosome-binding site for the genethat encodes the leader peptide(f) Changing several nucleotides in sequence 3 so thatit can base-pair with sequence 4 but not with sequence 2arrow_forwardDNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.arrow_forwardMatching type: Choose the effect of the given agents to translation or transcription Choices: RNA polymerase II inhibition Prevention of ribosomal movement in eukaryotes RNA polymerase inhibition Disruption of elongation stage of translation Prevention of ribosomal movement in prokaryotes Disruption of initiation stage of translation 1. Amanitin 2. Tetracycline 3. Diphtheria toxin 4. Rifampicin 5. Puromycinarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY