![Prescott's Microbiology](https://www.bartleby.com/isbn_cover_images/9781260409062/9781260409062_largeCoverImage.gif)
Prescott's Microbiology
11th Edition
ISBN: 9781260409062
Author: WILLEY, Joanne
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13.7, Problem 2MI
MICRO INQUIRY What would be the outcome if an aminoacyl-tRNA synthetase added the wrong amino acid to a tRNA (i.e., the anticodon specified a different amino acid than that added to the 3' end of the tRNA)?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
1Need help:. draw valine-aminoacyl tRNA synthetase. Show the
tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw
the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme.
Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes
in every cell.
Please do answer all the questions. I'll definitely give a like
You discovered a halophilic bacterium and want to characterize the mechanism involved in producing mature tRNA molecules from larger tRNA precursors. You isolated a large complex composed of a protein component and an RNA component that is capable of cleaving the larger tRNA precursor. To determine which one of the two components is responsible for catalysis, you perform an in vitro tRNA cleavage assay in the proper buffer conditions, including a low concentration of Mg2+ and 0.5 M bovine serum albumin (BSA). BSA is not specific for this reaction. The table below summarizes the results after performing eight separate reactions. The + symbol indicates the included reaction components.
Q. Based on the results obtained, what can you conclude about the composition of the biological catalyst required for the maturation of tRNA?
Q. Indicate which reactions helped you make your conclusion. Why?
Q. Which reactions allowed you…
What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases.
a.
Class I synthetases acylate the terminal 2’ hydroxyl group of tRNAs; Class II synthetases acylate the terminal 3’ hydroxyl group of tRNAs.
b.
Class I synthetases acylate the terminal 3’ hydroxyl group of tRNAs; Class II synthetases acylate the terminal 2’ hydroxyl group of tRNAs.
c.
Class I synthetases acylate tRNAs with hydrophobic amino acids; Class II synthetases acylate tRNAs with polar amino acids.
d.
Class I synthetases acylate tRNAs with polar amino acids; Class II synthetases acylate tRNAs with hydrophobic amino acids.
Chapter 13 Solutions
Prescott's Microbiology
Ch. 13.1 - MICRO INQUIRY Based on what we now know about...Ch. 13.1 - Prob. 2MICh. 13.1 - Retrieve, Infer, Apply 1. Briefly summarize the...Ch. 13.1 - Retrieve, Infer, Apply 2. Explain how protein was...Ch. 13.2 - MICRO INQUIRY To which carbon of ribose...Ch. 13.2 - MICRO INQUIRY How many H bonds are there between...Ch. 13.2 - Prob. 3MICh. 13.2 - Prob. 1CCCh. 13.2 - Retrieve, Infer, Apply What does it mean to say...Ch. 13.2 - Retrieve, Infer, Apply Amino acids are described...
Ch. 13.3 - MICRO INQUIRY What provides the energy to fuel...Ch. 13.3 - MICRO INQUIRY What is the difference between...Ch. 13.3 - MICRO INQUIRY Why cant DNA polymerase I perform...Ch. 13.3 - Retrieve, Infer, Apply How many replicons do...Ch. 13.3 - Prob. 2CCCh. 13.3 - Retrieve, Infer, Apply Describe the nature and...Ch. 13.3 - Retrieve, Infer, Apply Outline the steps Involved...Ch. 13.3 - Retrieve, Infer, Apply What is the end replication...Ch. 13.4 - Why is the nontemplate strand called the sense...Ch. 13.4 - Retrieve, Infer, Apply The coding region of a gene...Ch. 13.4 - Which strand of a gene has sequences that...Ch. 13.4 - Briefly discuss the general organization of tRNA...Ch. 13.5 - MICRO INQUIRY Are the -35 and -10 regions...Ch. 13.5 - Retrieve, Infer, Apply Outline the transcription...Ch. 13.5 - Retrieve, Infer, Apply What is a polycistronic...Ch. 13.5 - Retrieve, Infer, Apply What is a consensus...Ch. 13.5 - Tabulate the similarities and differences between...Ch. 13.6 - Prob. 1MICh. 13.6 - What is the difference between a codon and an...Ch. 13.6 - Prob. 2CCCh. 13.6 - Retrieve, Infer, Apply What is meant by code...Ch. 13.6 - Retrieve, Infer, Apply Is the genetic code truly...Ch. 13.7 - MICRO INQUIRY Why is simultaneous transcription...Ch. 13.7 - MICRO INQUIRY What would be the outcome if an...Ch. 13.7 - MICRO INQUIRY Why would it be impossible for...Ch. 13.7 - MICRO INQUIRY What provides the energy to fuel...Ch. 13.7 - Retrieve, Infer, Apply In which direction are...Ch. 13.7 - Retrieve, Infer, Apply Briefly describe the...Ch. 13.7 - Retrieve, Infer, Apply What are the translational...Ch. 13.7 - Prob. 4CCCh. 13.7 - Retrieve, Infer, Apply How many ATP and GTP...Ch. 13.8 - Prob. 1CCCh. 13.8 - Prob. 2CCCh. 13.8 - Retrieve, Infer, Apply Give the major...Ch. 13.8 - Prob. 4CCCh. 13 - Prob. 1RCCh. 13 - Prob. 2RCCh. 13 - Prob. 3RCCh. 13 - Prob. 4RCCh. 13 - Prob. 5RCCh. 13 - Streptomyces coelicolor has a linear chromosome....Ch. 13 - You have isolated several E. coli mutants: Mutant...Ch. 13 - Prob. 3ALCh. 13 - Prob. 4AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.arrow_forwardNeed help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?arrow_forwardGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forward
- AGUC 24. Use the table below to answer the following question. The template strand of a gene contains this sequence: 3'-TAC TAG GCT AGT TGA-5'. A mutation occurs due to exposure to a chemical mutagen that changes the gene sequence to 3'-TAC TAG ACT AGT TGA-5'. How does this mutation affect the resulting amino acid sequence? (LS3-2) * Second mRNA base A UCU UGU Cys UGC UUU UAU Tyr UAC Phe UUC U UCC Ser UCA Phe Gly (G) Leu Glu (F) (L) UUA UAA Stop UGA Stop A Ser Asp (E) (D) Leu (S) UCG UUG UAG Stop UGG Trp Tyr (Y) Ala CUU CCU CAU CGU U (A) His C G U A CỤC Leu CUA CC Pro CCA CAC CGC Arg CGA Cys (C) G A Val CAA (V) Gln G Trp (W) CUG CCG CAG CGG G Arg (R) G А С A Leu AUU ACU AAU AGU (L) Asn Ser Ser (S) AUC Ile ACC Thr ACA AAC AGC C/ Lys (K) UGA AUA Pro AAA Lys AAG AGA Arg AGG Asn (N) (P) AUG Met or start ACG His Thr (T) Gin (H) (Q) GUU GCU GAU GGU lle Asp Arg (R) (1) GUC Val GUA GCC GAC GGC Ala GCA Gly GGA GAA Glu GAG GUG GCG GGG The mutation changes a single amino acid to another amino…arrow_forwardYeast have 8 similar tRNA genes with the anticodon 5’-GUA. A researcher mutates one of these genes to change its anticodon to 5’-GUU. a) What codon did the tRNA originally decode? b) What codon does the mutated tRNA decode?arrow_forwardIn the absence of cladosporin, explain the initiation steps in the synthesis of lysyl-tRNA synthetase enzyme or protein in the bacterial cell, with the involvement of all initiation factors, each site in the ribosome, any important conserved sequence, subunits of ribosomes, initiation codon, charged tRNA containing what amino acid, whether it requires ATP or GTParrow_forward
- Position on the small and large ribosomal subunits which the peptidyl-tRNA occupies prior to peptide bond formation Group of answer choices a)No answer text provided. b)A Site c)P Sitearrow_forwardStructural analysis of bacterial release factor 1 (RF-1) and release factor-2 (RF-2) reveals that these proteins are similar in size and shape to a tRNA molecule. This similarity has sometimes been called molecular mimicry. Why might RF-1 and RF-2 have evolved to mimic tRNA?arrow_forwardYeast have 8 similar tRNA genes with the anticodon 5'-GUA. A researcher mutates one of these genes to change its anticodon to 5'-GUU. a) What codon did the tRNA originally decode? Name the amino acid. b) What codon does the mutated tRNA decode? Name the amino acid.arrow_forward
- Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize mRNA containing A's and G's only (poly-AG in random order). 2. Convert the amino acid Glutamic acid (Glu) on its tRNA to the amino acid Glutamine (Gln) as shown below. 3. Mix your poly-AG RNA, your artificial tRNA, and cell extract (contains ribosomes, amino acids, all normal tRNAs, and the energy source for translation). Phe Tyr GAA GAA Glutamic acid (Glu) is encoded by GAA and GAG, while Glutamine (Gln) is encoded only by CAA and CAG. What does the outcome of this experiment tell us about translation? Multiple codons code for each amino acid. An amino acid is selected based on the identity of the tRNA. The ribosome does the translation, i.e. it selects the amino acid regardless of the identify of the tRNA. The ribosome reads mRNA 3 bases at a time.arrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY