BIOLOGY (LOOSELEAF)-W/CONNECT
12th Edition
ISBN: 9781260692181
Author: Raven
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14, Problem 4IQ
Summary Introduction
To determine: The
Introduction: The enzyme adenine methylase is responsible for adding methyl groups to the DNA strand. The enzyme works in the 5’-GATC-3’ to the newly synthesized DNA strands.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
You are interested in studying resistance to heavy metals and have selected the yeast Saccharomyces cerevisea to conduct your studies. You have recovered a deletion mutant that does not tolerate high concentrations of zinc (grows poorly in zinc containing media ) and have designated the mutant pgz-1 (for poor growth in zinc ). (a) What is the advantage to the type of mutant used in this work? What class of mutagen was likely use to generate pgz-1?
( b) Do you expect the PGZ gene to be expressed in your mutant? Explain.
Five individual His- mutants (hisA, his B, hisC, hisD and his E) were isolated. The genes are all
involved in the histidine biosynthetic pathway. A crossfeeding experiment was carried out to
determine the order of the enzymes encoded by these genes. The result is shown (A, B, C, D and E
represent the mutants hisA, his B, hisC, hisD and his E, respectively. Dark area indicates bacterial
growth).
From the result shown, what might be the histidine biosynthetic pathway (the order of enzymes)?
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
Chapter 14 Solutions
BIOLOGY (LOOSELEAF)-W/CONNECT
Ch. 14.1 - Describe the experiments of Griffith and Avery.Ch. 14.1 - Evaluate the evidence for DNA as genetic material.Ch. 14.2 - Explain how the WatsonCrick structure rationalized...Ch. 14.2 - Prob. 2LOCh. 14.3 - Prob. 1LOCh. 14.3 - Prob. 2LOCh. 14.4 - Prob. 1LOCh. 14.4 - Prob. 2LOCh. 14.4 - Diagram the functions found at the replication...Ch. 14.5 - Compare eukaryotic replication with prokaryotic.
Ch. 14.5 - Prob. 2LOCh. 14.5 - Prob. 3LOCh. 14.6 - Prob. 1LOCh. 14.6 - Prob. 2LOCh. 14 - Prob. 1DACh. 14 - Prob. 2DACh. 14 - Prob. 1IQCh. 14 - Prob. 2IQCh. 14 - How does the structure of eukaryotic genomes...Ch. 14 - Prob. 4IQCh. 14 - Prob. 1UCh. 14 - Which of the following is NOT a component of DNA?...Ch. 14 - Chargaff studied the composition of DNA from...Ch. 14 - The bonds that hold two complementary strands of...Ch. 14 - Prob. 5UCh. 14 - Prob. 6UCh. 14 - Which of the following is NOT pan of the...Ch. 14 - If one strand of a DNA is 5 ATCGTTAAGCGAGTCA 3,...Ch. 14 - Hershey and Chase used radioactive phosphorus and...Ch. 14 - The Meselson and Stahl experiment used a density...Ch. 14 - Prob. 4ACh. 14 - If the activity of DNA ligase was removed from...Ch. 14 - Successful DNA synthesis requires all of the...Ch. 14 - The synthesis of telomeres a. uses DNA polymerase,...Ch. 14 - When mutations that affected DNA replication were...Ch. 14 - Prob. 1SCh. 14 - In the Meselson-Stahl experiment, a control...Ch. 14 - Enzyme function is critically important for the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A mutant has no activity for the enzyme isocitrate lyase.Does this result prove that the mutation is in the geneencoding isocitrate lyase?arrow_forwardThe intermediates A, B, C, D, E, and F all occur in the same biochemical pathway G is the product of the pathway, and mutations 1 through 7 are all G –, meaning that they cannot produce substance G. The following table shows which intermediates will promote growth in each of the mutants. Arrange the intermediates in order of their occurrence in the pathway at which each mutant strain is blocked. A “+” in the table indicates that the strain will grow if given that substance, an “o” means lack of growth.arrow_forwardCTP synthetase catalyzes the glutamine-dependent conversion of UTP to CTP. The enzyme is allosterically inhibited by the product, CTP. Mamma- lian cells defective in this allosteric inhibition are found to have a complex phenotype: They require thymidine in the growth medium, they have unbal- anced nucleotide pools, and they have an elevated spontaneous mutation rate. Explain the likely basis for these observations.arrow_forward
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forwardIn studies of the amino acid sequence of wild-type and mutant forms of tryptophan synthetase in E. coli, the following changes have been observed: Determine a set of triplet codes in which only a single-nucleotide change produces each amino acid change.arrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forward
- The following table lists 4 bacterial strains that are partial diploids for lac operon genes. Given the activity of beta-galactosidase measured for each strain in the absence (-lac) or presence (+lac) of lactose, complete the table by choosing the appropriate symbol (+, -, C, S) to indicate the allele of the gene or site missing from the table (blue numbers). strain A BC 5 C D 7 chromosome I O 1 2 4 1 [Select] 9 3 [Select] [Select] [Select] 9 [Select] + + Z + + 6 + I +5 + 10 plasmid O 3 + 7 C Z + 8 8 2 [Select] 4 [Select] 6 [Select] B-gal act. -lac +lac 0.002 0.003 0.002 0.058 0.063 0.121 0.059 0.062 Select] 1 ✔ [ Select] + is C Sarrow_forwardThe human hexokinase enzyme has the same function as the bacterial hexokinase enzyme but is somewhat different in its amino acid sequence. You have obtained a mutant bacterial strain in which the gene for hexokinase is missing. If you introduce into your mutant strain a DNA plasmid engineered to contain the DNA coding sequence of the human hexokinase gene, what must you also include? a)The human hexokinase promoter b)The bacterial hexokinase promoter c)Both the human and bacterial promoters d)You cannot engineer a bacteria to produce a human enzymearrow_forwardSuppose a researcher previously cloned gene Y into M13 bacteriophage vector. Gene Y encodes a product called peptide Y. A region of gene Y contains the DNA sequence ATG-CGC-GAA-CTG-GTG-AAC-TAA. The researcher wishes to change a Val residue to an Ala residue in this region of peptide Y using site-directed mutagenesis. What should be the sequence of the mutant oligonucleotide primer in this region? You may use a codon table. mutant oligonucleotide primer sequence: GGC-GGC-GAA-CTG-GTG-AAC-TAA Incorrectarrow_forward
- Why would a mutation in a somatic cell of a multicellular organism escape detection?arrow_forwardWhy are there no Pol I mutants that completely lack 5′ → 3′ exonucleaseactivity?arrow_forwardAfter Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY