Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 14.4, Problem 1CS
Summary Introduction
To determine: The composition of a nucleosome with reference to figure 11.22 given in the text book.
Introduction: Nucleosome can be defined as repeating units of chromatin of eukaryotic organisms that are approximately eleven nanometers in diameter at its widest point.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
VISUAL SKILLS If the DNA pol I in a given cell werenonfunctional, how would that affect the synthesis ofa leading strand? In the overview box in Figure 16.17,point out where DNA pol I would normally function onthe top leading strand.
real w1 analyze
1. Why do you think RNA cannot serve as the genetic material of most livingorganisms?2. What do you think will happen if an error during DNA replication ultimately
results in the change of UGA codon to UGG?
Quick help Only cell biology
Which process is described in the following paragraph?
During DNA synthesis, before the enzyme adds the next nucleotide to a growing DNA strand, it checks whether the previously added nucleotide is correctly base-paired to the template strand. If so, the polymerase adds the next nucleotide; if not, the polymerase clips off the mispaired nucleotide and tries again. This is carried out by cleaving the phosphodiester backbone using the enzyme’s 3’-to-5’ exonuclease activity.
Chapter 14 Solutions
Biology
Ch. 14.1 - Prob. 1CCCh. 14.2 - Which genes are under the control of the lac...Ch. 14.2 - With regard to regulatory proteins and small...Ch. 14.2 - What were the key observations made by Jacob,...Ch. 14.2 - CoreSKILL What was the eventual hypothesis...Ch. 14.2 - Prob. 3EQCh. 14.2 - Core Skill: Connections Look back at Fig 9.12....Ch. 14.2 - What are the advantages of having both an...Ch. 14.2 - Prob. 2CSCh. 14.3 - Prob. 1CC
Ch. 14.4 - What are the two opposing effects that histone...Ch. 14.4 - Prob. 1CSCh. 14.5 - Prob. 1CCCh. 14.5 - Prob. 2CCCh. 14 - Prob. 1TYCh. 14 - Prob. 2TYCh. 14 - Transcription factors that bind to DNA and...Ch. 14 - Prob. 4TYCh. 14 - For the lac operon, what would be the expected...Ch. 14 - Prob. 6TYCh. 14 - The trp operon is considered _____ blank operon...Ch. 14 - Prob. 8TYCh. 14 - Prob. 9TYCh. 14 - _____ blank refers to the process that allows a...Ch. 14 - Prob. 1CQCh. 14 - Transcriptional regulation often involves a...Ch. 14 - Prob. 3CQCh. 14 - Discuss the advantages and disadvantages of...Ch. 14 - Discuss the advantages and disadvantages of...
Knowledge Booster
Similar questions
- Question:- Define the transcription unit. How does it differ from the gene? Describe how you would determine the 5' and 3' ends of a transcription unit in a genome browser.arrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:arrow_forwardMAKE CONNECTIONS Speculate about whether thesame enzyme could methylate both a histone and a DNAbase. (See Concept 5.4.)arrow_forward
- BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC. 2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step…arrow_forwardA cDNA clone contains (a) introns (b) exons (c) anticodons (d) a and b (e) b and carrow_forwardVISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA, translation, DNA, transcription, and polypeptide.arrow_forward
- Helping tags: Biology, developmental biology, development process Question: What may be concluded if a particular replacement experiment revealed no foreign growths at the site of cell mass insertion? Explain your answer. * Will UPVOTE, just please help me answer the question. Thanks.arrow_forwardNeed help fast What length of DNA (based on the number of subunits) has a potential diversity close to 3 *10^16?arrow_forwardTranscribing and translating transcribe and translate the following DNA molecules DNA:GCTAGTACGTGCACATTAGAA mRNA: amino acids:arrow_forward
- Matching type Choices are in the picture 1. simultaneous and rapid process producing mRNA and polypeptide 2. cleaving the polypeptide by adding water 3. three initiation factors are required to commence the process 4. removal of gene segment disrupting the message 5. single mRNA codes for the proteomearrow_forwardQ1. Predict the effects (on translation of coat gene and replicase gene) of the following mutations on phage R17 coat gene and replicase gene translation and explain the logic of your answers: a. An amber mutation (premature stop codon) six codons downstream of the coat gene initiation codon. b. Mutations in the stem loop around the coat gene initiation codon that weakens the base-pairing in the stem loop. c. Mutations in the interior of the replicase gene that cause it to base-pair with the coat gene initiation codon.arrow_forwardBased on the "initial transcription by RNA polymerase proceeds through a DNA- scrunching mechanism" paper why this research is important? Point out what we knew before this research about the initial transcription.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning