Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Question
Chapter 14.4, Problem 3R
Summary Introduction
To review:
The discrepancies that would occur if a gene of 1,440 base pairs codes for a polypeptide chain of 192 amino acids.
Introduction:
The code on deoxyribonucleic acid (DNA) in the form of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A gene contains 30% thymine. What is the percentage of pyrimidines present in this segment? Explain.
Why is the AT base pair less stable than the GC base pair?
Remove codons 24 to 66, inclusive
AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCGGCUUUUUCUAUACCAGAAGGGAGGAUUUGCAAGUUGGCCAAGAAUUAGGCGGCGGUCCCGGGGCGGGGAGUCUUCAACCAAGUCUGCAAAAACGGGGCAUUGUUGAACAAUGUUGUACCAGUAUUUGCAGUCUCUACCAGUUAGAGAAUUACUGA
Chapter 14 Solutions
Life: The Science of Biology
Knowledge Booster
Similar questions
- What portions of the above genomic sequence actually code for amino acids?arrow_forwardAre the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCGarrow_forwardIn the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?arrow_forward
- For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'arrow_forwardWhat happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?arrow_forwardConsider the following coding sequence transcribed from 5' to 3'5' A T G A A G C G C T C A G T A 3' If a guanine is substituted for nucleotide 11 what type of base substitution has occurred (nucleotide level) and what would be the resulting phenotypic effect?arrow_forward
- For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the DNA as packaged in nucleosomes with linker histones present.arrow_forwardExplain why the sequences of these two genes are similar to each other but not identical.arrow_forwardDraw the structure of a G ∙ U base pair.arrow_forward
- If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?arrow_forwardIf the gene undergoing protein synthesis consists of 24 bases, how many codons does that result in? How many amino acids will the protein consist of?arrow_forwardThe protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education