Study Guide And Solutions Manual For Genetic Analysis: An Integrated Approach
Study Guide And Solutions Manual For Genetic Analysis: An Integrated Approach
3rd Edition
ISBN: 9780134832258
Author: Mark F. Sanders, John L. Bowman, Peter Mirabito
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 15, Problem 19P

You have isolated a genomic clone with an EcoR I fragment of 11 kbthat encompasses the CRABS CLAW gene (see Problem 18 ). You digest the genomic clone with Hind III and note that the 11- kbEcoR I fragment is split into three fragments of 9 kb, 1.5 kb, and 0.5 kb.

Does this tell you anything about where the CRABS CLAW gene is located within the 11- kb genomic clone?

Restriction enzyme sites within a cDNA clone are often also in the genomic sequence. Can you think of a reason why occasionally this is not the case? What about the converse: Are restriction enzyme sites in a genomic clone always in a cDNA clone of the same gene?

To further analyze the CRABS CLAW gene (see Problems 19 and 20 ), you create a map of the genomic clone. The 11- kb EcoRI fragment is cloned into the EcoRI site of the MCS of the vector shown in Problem 18 . You digest the double - stranded form of the genome with several restriction enzymes and obtain the following results. Draw, as far as possible, a map of the genomic clone of CRABS CLAW.

Chapter 15, Problem 19P, You have isolated a genomic clone with an EcoR I fragment of 11 kbthat encompasses the CRABS CLAW

What restriction digest would help resolve any ambiguity in the map?

Blurred answer
Students have asked these similar questions
Knowing that you are using HindIII and EcoRI to cut your plasmids, and that those two enzymes cut within the MCS, use the map of pUC19 provided below to compute: What will be the sizes of the 2 restriction fragments if NO insert is present in pUC19? What will be the sizes of the 2 restriction fragments if the approximately 317 bp RT-PCR product (insert from WT satC dimer) was ligated successfully into the SmaI site? What will be the sizes of the 2 restriction fragments if TWO approximately 317 bp RT-PCR products (2 ligated inserts from WT satC dimer) were ligated into the SmaI site?
You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline:   Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing.    The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%).   A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA.   The secondary structure of the primer must be none or weak.   No primer dimers (The primer anneals to itself).   3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…
Many restriction endonuclease recognition sequences are palindromes. What are palindromes? Are the recognition sequences for AatII and DraI palindromes? Some restriction endonucleases produce blunt-ended pieces of DNA, while other produce DNA fragments with sticky ends. What is the difference? What type of ends do AatII and DraI produce?

Chapter 15 Solutions

Study Guide And Solutions Manual For Genetic Analysis: An Integrated Approach

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license