Study Guide And Solutions Manual For Genetic Analysis: An Integrated Approach
3rd Edition
ISBN: 9780134832258
Author: Mark F. Sanders, John L. Bowman, Peter Mirabito
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 4P
You have constructed four different libraries: a genomic library made from DNA isolated from human brain tissue, a genomic library made from DNA isolated from human muscle tissue, a human brain cDNA library, and a human muscle cDNA library.
Which of these would have the greatest diversity of sequences?
Would the sequences contained in each library be expected to overlap completely, partially, or not at all with the sequences present in another of the libraries?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A molecular biologist wants to isolate a gene from a scorpion that encodes the deadly toxin found in its stinger, with the ultimate purpose of transferring this gene to bacteria and producing the toxin for use as a commercial pesticide. Isolating the gene requires a DNA library. Should the molecular biologist create a genomic library or a cDNA library? Explain your reasoning.
How many Illumina clusters would you need to generate 15X coverage of the human genome, assuming your read lenght is 600 bp? (assume a human genome size of 3 billion bp)
- 2.5 billion
- 75 million
- 7 million
- 100 million
A researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the bacterial genome is smaller, but that there are more genes for a given number of base pairs in the eukaryotic cells. In other words, there are fewer genes per unit of length of DNA in the eukaryotic cells. What do you predict she will find if she examines the DNA more closely?
A. All of the bacterial DNA consists of coding sequences, but this is not true of the eukaryotic DNA.
B. There are more repetitive sequences in the eukaryotic DNA than in the bacterial DNA.
C. There are densely packed genes in the eukaryotic DNA that were not immediately distinguishable during the first analysis.
D. The bacteria have larger quantities of noncoding DNA than the eukaryotic cells.
Chapter 15 Solutions
Study Guide And Solutions Manual For Genetic Analysis: An Integrated Approach
Ch. 15 - 15.1 What purpose do the bla and lacZ genes serve...Ch. 15 - The human genome is 3109 bp in length. How many...Ch. 15 - 15.3 Ligase catalyzes a reaction between the...Ch. 15 - You have constructed four different libraries: a...Ch. 15 - Using the genomic libraries in Problem 4, you wish...Ch. 15 - The human genome is 3109bp. You wish to design a...Ch. 15 - 15.7 Using animal models of human diseases can...Ch. 15 - 15.8 Compare methods for constructing homologous...Ch. 15 - 15.9 Chimeric genefusion products can be used for...Ch. 15 - 15.10 Why are diseases of the blood simpler...
Ch. 15 - Injection of double-stranded RNA can lead to gene...Ch. 15 - Compare and contrast methods for making transgenic...Ch. 15 - 15.13 It is often desirable to insert cDNAs into a...Ch. 15 - 15.14 A major advance in the s was the development...Ch. 15 - 15.15 The bacteriophage lambda genome can exist in...Ch. 15 - 15.16 The restriction enzymes Xho and Sal cut...Ch. 15 - 15.17 The bacteriophage has a single-stranded DNA...Ch. 15 - 15.18 To further analyze the CRABS CLAW gene (see...Ch. 15 - You have isolated a genomic clone with an EcoR I...Ch. 15 - 15.20 You have identified a cDNA clone that...Ch. 15 - 15.21 You have isolated another cDNA clone of the...Ch. 15 - 15.22 You have identified five genes in S....Ch. 15 - You have generated three transgenic lines of maize...Ch. 15 - 15.24 Bacterial Pseudomonas species often possess...Ch. 15 - 15.25 Two complaints about some transgenic plants...Ch. 15 - 15.26 In Drosophila, lossoffunction Ultrabithorax...Ch. 15 - Prob. 27PCh. 15 - The highlighted sequence shown below is the one...Ch. 15 - Vitamin E is the name for a set of chemically...Ch. 15 - The RAS gene encodes a signaling protein that...Ch. 15 - 15.31 You have cloned a gene for an enzyme that...Ch. 15 - 15.32 About of occurrences of nonautoimmune type...Ch. 15 - Describe how having the Cas 9 gene at a genomic...Ch. 15 - 15.34 Would a gene drive system spread rapidly...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options. Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein. Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure. Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins. Protein sequences are expected to evolve and…arrow_forwardYou have isolated a transposable element from the human genome and have determined its DNA sequence.How would you use this sequence to determine thecopy number of the element in the human genome ifyou just had a computer with an Internet connection?arrow_forwardIf a pair of 10-mer primers are used in a PCR, what would be the number of expected binding sites in a human genomic DNA? (You can use approximate values.)arrow_forward
- If you were offered the chance to have the genome of your newborn sequenced at a cost of 1,000, would you do so?arrow_forwardBioinformatics is the science of using computational methods (specialized software) to decipher the biological meaning of information contained within organismal system. Comparisons of experimental data involving DNA sequences generated by different laboratories are critically dependent on the use of a universally agreed-upon standard of analysis. Which of the following is universally used as the agreed-upon standard of analysis for these comparisons? Group of answer choices A GenBank database. A species reference sequence (RefSeq) system. A genomic library collection. A ChIP/chip analysis system.arrow_forwardWhat advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.arrow_forward
- The genome of Drosophila melanogaster, a fruit fly, was sequenced in 2000. However, this “completed” sequence did not include most heterochromatin regions. The heterochromatin was not sequenced until 2007 (R. A. Hoskins et al. 2007. Science 316:1625–1628). Most completed genome sequences do not include heterochromatin. Why is heterochromatin usually not sequenced in genome-sequencing projects?arrow_forwardWhat is a database? What types of information are stored within adatabase? Where does the information come from? Discuss theobjectives of a genome database.arrow_forwardShown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'arrow_forward
- If you had the ability to do gene editing with ONE gene for the betterment of human kind, which one would you choose, and why? Assume you could either change an abnormal allele associated with a disease, such as the cystin gene associated with Cystic Fibrosis to its normal wild type, or add a pre-existing human allele to a genome.arrow_forwardIf I take random biological sequences from a data bank, I see even more sequence similarity. Why ?arrow_forwardConsider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the genome, resulting in 20 reads, with an average length of 50 bp. A very important point is that, even though 20×50 = 1000, there is no guarantee that ALL 1000 bp of the genome are represented in the fragments. Calculate the coverage. What does this value mean? Why would it be a good idea to have a coverage greater than 1?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license