EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 14PDQ
Neelaredoxin is a 15-kDa protein that is a gene product common in anaerobic bacteria. It has superoxide-scavenging activity, and it is constitutively expressed. In addition, its expression is not further induced during its exposure to O2 or H2O2 (Silva, G. et al. (2001). J. Bacteriol. 183:4413–4420). What do the terms constitutively expressed and induced mean in terms of neelaredoxin synthesis?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
You are interested in the activity and regulation of a protease made by the Gram-positive bacterium Geobacillus stearothermophilus. What would be the purpose of constructing each of the following: a His-tagged protease, a transcriptional GFP fusion to the protease gene, and a translational GFP fusion to the protease gene?
"what is the reason for forming mucoid colonies in some types of bacteria?"
I have this strain of e coli.
Is P+ o+ Z+ Y+ / I- P+ oC Z- Y+
Will beta-galactosidase and permease be expressed? If they are will they be inducible or constitutive?
Chapter 16 Solutions
EBK CONCEPTS OF GENETICS
Ch. 16 - Even though the lac Z, Y, and A structural genes...Ch. 16 - Predict the level of genetic activity of the lac...Ch. 16 - Prob. 1CSCh. 16 - Prob. 2CSCh. 16 - Prob. 3CSCh. 16 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 16 - Prob. 2PDQCh. 16 - Contrast positive versus negative control of gene...Ch. 16 - Contrast the role of the repressor in an inducible...Ch. 16 - For the lac genotypes shown in the following...
Ch. 16 - For the genotypes and conditions (lactose present...Ch. 16 - The locations of numerous lacI and lacIS mutations...Ch. 16 - Prob. 8PDQCh. 16 - Prob. 9PDQCh. 16 - Predict the effect on the inducibility of the lac...Ch. 16 - Erythritol, a natural sugar abundant in fruits and...Ch. 16 - Prob. 12PDQCh. 16 - Prob. 13PDQCh. 16 - Neelaredoxin is a 15-kDa protein that is a gene...Ch. 16 - The creation of milk products such as cheeses and...Ch. 16 - Both attenuation of the trp operon in E. coli and...Ch. 16 - Prob. 17PDQCh. 16 - Prob. 18ESPCh. 16 - In a theoretical operon, genes A, B, C, and D...Ch. 16 - A bacterial operon is responsible for the...Ch. 16 - A marine bacterium is isolated and shown to...Ch. 16 - Prob. 22ESPCh. 16 - Prob. 23ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Clary Leonhart used the pET vector system to express her prokaryotic amylase enzyme. She added peptone into her culture broth of BL21 (DE3) Escherichia coli strain. At the end of the experiment, she discovered that her protein was not expressed. She repeated three more times but her protein of interest was still not produced. (i) (ii) Explain the reason why Clary failed to obtain her protein of interest and suggest a solution to troubleshoot this problem. Clary plans to express her protein along with a polyhistidine-tag, or better known by its trademarked name IIis-tag. Explain the importance of His-tag in protein work.arrow_forwardA number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the highest beta-galactosidase enzyme activity, when grown in the lactose medium. O CAP+ r* p* o* z O CAP* I P* o* z* O CAP* r* P O* z* O CAP I P* O z*arrow_forwardIn the: A mutated TBP protein Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?arrow_forward
- For the lac genotypes of Escherichia coli shown in the following Table 1, predict the expression of beta-galactosidase (Z) and permease (Y) is inducible or noninducible or constitutive. Explain your answer. Table 1 Genotype I-P+O+Z+Y+ (i) (ii) I+P+OCZ+Y+ (iii) ISP+O+Z+Y+ (iv) I+P+O+Z+Y-//I+P-O+Z+Y+ (v) ISP+OcZ+Y+//I-P+O+Z+Y- Condition No lactose No lactose lactose lactose No lactosearrow_forwardConsider the gal10D56 reporter gene. In 300 words or fewer, describe 1) the role of GAL7 in galactose metabolism and its importance for cell function 2) the mutation present in the gal10D56 reporter gene 3) the consequence of this mutation for GAL7 expression in wild type cells, 4) the mechanism by which certain mutations can suppress the effects of gal10D56, and 5) the specific purpose for using this reporter gene.arrow_forwardMabelle used the pET vector system to express her prokaryotic amylase enzyme. She added IPTG into her culture broth of DH5a Escherichia coli strain. At the end of the experiment, she discovered that her protein was not expressed. She repeated three more times but her protein of interest was still not produced. (i) (ii) Explain the reason why Mabelle failed to obtain her protein of interest and suggest a solution to troubleshoot this problem. Mabelle plans to express her protein fused to a polyhistidine-tag (His-tag). Explain the importance of His-tag in protein work.arrow_forward
- A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the highest beta-galactosidase enzyme activity, when grown in the lactose medium. CAP It P+ O`Z+ CAP+ I P+ O+ Zt CAP+ It P- O+ Z+ CAP+ It P+ 0+ Zarrow_forwardVarious antimicrobial drugs to treat microbial infection have diverse mechanism of action. Consider the following antimicrobial drugs: A. Seconeolitsine, known as DNA topoisomerase I inhibitor in bacteria. (i) Explain briefly how inhibiting DNA topoisomerase I is a good mechanism of action for an antibiotic, include possible molecular machineries being targeted. (ii) What would be an appropriate response if seconeolitsine works well by stating the state of supercoiling in bacteria. (iii) To prove your answer (ii), you test the condition of bacterial DNA by running gel electrophoresis, one has been treated with seconeolitsine (+ sample) and the other one is not (- sample). Explain the position of each + sample and – sample band on the gel in reference to the point of origin (where you load your samples) or how far each DNA sample travel across agarose gel. (iv) Explain why you would expect answer (iii) for each + sample and – sample. B.…arrow_forwardA number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the lowest beta-galactosidase enzyme activity, when grown in the lactose medium. Orpt o* z* r* Orpt ot z* Y OrptoztY Orrotzr OrPotz*Yarrow_forward
- For the following genotypes of E. coli strains, state whetherenzyme activity is inducible (I), constitutive (C), or uninducible (U).Key to symbols in table:z = structural gene for -galactosidasey = structural gene for permeasea = structural gene for transacetylasep = promoter (for lac operon)i = structural gene for the lac repressor (regulator gene)o = operator (binding site for repressor)Genotype -gal (z) Permease (y) Transacetylase (a)i+ p+ oC z- y- a+i- p+ o+ z+ y- a- /i+ p- oc z- y+ a-i- p+ o+ z+ y- a+ /i+ p+ oc z- y+ a-i+ p+ o+ z- y- a+i- p- o+ z+ y- a+ /i- p+ o+ z- y+ a-iS p+ o+ z- y- a+i- p+ o+ z+ y- a+ /i+ p- oc z- y+ a-is p+ o+ z- y+ a+ /i+ p+ oc z+ y- a-i- p- o+ z+ y- a+ /i- p+ o+ z- y- a-is p+ oc z+ y- a+i+ p+ oc z+ y- a+arrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardThe streptolysin S toxin made by S. pyogenes is encoded by a 9-gene operon, sagABCDEFGHI. Thinking about what a 3-line diagram would look like for this operon, answer the following questions. Write numeric answers only. For example, if your answer is 6 promoters, write only 6. 1) How many promoters control the expression of these genes? 2) How many locations does RNA Polymerase bind to get full expression of these genes? 3) How many ribosome binding sites are needed for full protein expression? 4) How many start codons will be needed for full protein expression? 5) How many mRNA strands will be produced with full operon expression? 6) How many proteins will be produced with full protein expression? 1arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY