BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 5A
Eukaryotic mRNAs differ from prokaryotic mRNAs in that they
a. usually contain more than one gene.
b. are colinear with the genes that encode them.
c. are not colinear with the genes that encode them.
d. Both a and c are correct.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
If a human gene is found to contain five introns, the mature mRNA encoded by that gene would have how many exons?
a) four exons
b) five exons
c) six exons
d) there could be multiple mRNA that contain between one and six exons
a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends.
b. translate this RNA sequence in 1a into a protein sequence
c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends.
d. Translate this RNA sequence in 1c into a protein sequence
The Kozak rules determine
a. the choice of the start codon in complex eukaryotes.
b. the choice of the start codon in bacteria.
c. the site in the mRNA where translation ends.
d. how fast the mRNA is translated.
Chapter 16 Solutions
BIOLOGY
Ch. 16.1 - Prob. 1LOCh. 16.1 - Prob. 2LOCh. 16.1 - Prob. 3LOCh. 16.2 - Explain how proteins can interact with base-pairs...Ch. 16.2 - Prob. 2LOCh. 16.3 - Prob. 1LOCh. 16.3 - Prob. 2LOCh. 16.3 - Explain control of gene expression in the trp...Ch. 16.4 - Prob. 1LOCh. 16.4 - Prob. 2LO
Ch. 16.4 - Prob. 3LOCh. 16.5 - Describe at least two kinds of epigenetic mark.Ch. 16.5 - Explain the function of chromatin-remodeling...Ch. 16.6 - Prob. 1LOCh. 16.6 - Prob. 2LOCh. 16.7 - Prob. 1LOCh. 16.7 - Prob. 2LOCh. 16 - Prob. 1DACh. 16 - What advantage might a bacterium gain by linking...Ch. 16 - Prob. 2IQCh. 16 - Prob. 3IQCh. 16 - In prokaryotes, control of gene expression usually...Ch. 16 - Prob. 2UCh. 16 - Prob. 3UCh. 16 - The lac operon is controlled by two main proteins....Ch. 16 - In eukaryotes, binding of RNA polymerase to a...Ch. 16 - In eukaryotes, the regulation of gene expression...Ch. 16 - In the trp operon, the repressor binds to DNA a....Ch. 16 - Prob. 1ACh. 16 - Specific transcription factors in eukaryotes...Ch. 16 - Repression in the trp operon and induction in the...Ch. 16 - Regulation by small RNAs and alternative splicing...Ch. 16 - Eukaryotic mRNAs differ from prokaryotic mRNAs in...Ch. 16 - In the cell cycle, cyclin proteins are produced in...Ch. 16 - A mechanism of control in E. coli not discussed in...Ch. 16 - You have isolated a series of mutants affecting...Ch. 16 - Examples of positive and negative control of...Ch. 16 - What forms of eukaryotic control of gene...Ch. 16 - The number and type of proteins found in a cell...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- _______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acidsarrow_forwardWithin a cell, the amount of protein made using a given mRNA molecule depends partly on A. the presence of certain transcription factors. B. the rate at which the mRNA is degraded. C. the degree of DNA methylation. D. the number of introns present in the mRNA. please explain which is correct and incorrect and whyarrow_forwardEukaryotic mRNA is capped at the 5' end by: a. adding a poly A sequence to the 5' end. b. ligating a 7-methylguanylate via a 3’ linkage. c. methylating the base pairs near the 5’ end. d. forming a lariat structure via transesterification.arrow_forward
- Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardA scientist studies the production of a key digestive enzyme in silk moths. The moths have one gene for this enzyme, and the scientist extracts mRNA transcribed from this gene as well as protein translated from it. The gene has three introns in its sequence. If the researcher compares mRNA from inside the nucleus to mRNA from the ribosomes, what will be found? A. less mRNA in the nucleus B. shorter mRNA in the ribosomes C. identical mRNAs in both places D. mRNA covalently attached to protein in the nucleusarrow_forwardA mutation that changes the sequence of nucleotides in a promoter would result in a change in a. The amino acid sequence of the corresponding protein b. The base sequence of the corresponding mRNA c. How frequently the corresponding gene is transcribed d. The fidelity of translation of the corresponding mRNA 1 pointsarrow_forward
- The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome: Choose the sequence that would correspond to that mRNA. A: 3’ – TACGGAACG – 5’ B) 3’ – AUGCCUUGC – 5’ C) 5’ – AUGCCUUGC – 3’ D) 3’ – UACGGAACG – 5’ E) 5’ – UACGGAACG – 3’arrow_forwardIf a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative consequence(s) be? I chose b and got this questions wrong, why is this wrong? a. The mRNA would not properly exit the nucleus. b. The mRNA would not properly bind to a ribosome. c. The mRNA would not receive a poly A tail. d. The mRNA would not use the correct start codon. e. Both a and b are correct.arrow_forwardWhat is the genetic code? a. The relationship between a three-base codon sequence and an amino acid or the end of translation b. The entire base sequence of an mRNA molecule c. The entire sequence from the promoter to the terminator of a gene d. The binding of tRNA to mRNAarrow_forward
- A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNAarrow_forwardWhat is one function of the 5' cap in eukaryotic mRNA? Select one: a. It is involved in translation termination. b. It is an intron splicing signal. c. It is the initial attachment site for ribosomes. d. It is involved in polyadenylation of the 5' end of the mRNAarrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY