Prescott's Microbiology
11th Edition
ISBN: 9781260211887
Author: WILLEY, Sandman, Wood
Publisher: McGraw Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 4AL
You are interested in the activity and regulation of a protease made by the Gram-positive bacterium Geobacillus stearothermophilus. What would be the purpose of constructing each of the following: a His-tagged protease, a transcriptional GFP fusion to the protease gene, and a translational GFP fusion to the protease gene?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given the following genotypes, explain, by answering the questions in each number, how the mutation (identified by a (-) superscript) will affect E. coli grown in lactose medium.
Will there be a complete set ofgene products? (Yes/No)
Will the lac operon be turnedon/off?
Will the cell survive? (Yes/No)
a. i + p + o + z - y +
b. i + p - o + z + y +
c. i + p + o - z + y +
Suppose that E. coli sustains a mutation in its gene for the lac operon repressor such that the repressor is ineffective. What effect would this have on the bacterium’s ability to catabolize lactose? Would the mutant strain have an advantage over wild-type cells? Explain your answer.
Which of the following lac operon genotypes would allow for functional versions of all the structural enzymes of the lac operon to be expressed constitutively even in the absence of lactose?
Group of answer choices
I+ O+ Z+ Y+ A+
I- O+ Z- Y- A-
I+ OC Z+ Y+ A+
IS O+ Z+ Y+ A+
I+ O+ Z- Y+ A+
Chapter 17 Solutions
Prescott's Microbiology
Ch. 17.1 - Examine the uncut piece of DNA shown in the upper...Ch. 17.1 - Which of the above enzymes yield blunt ends? Which...Ch. 17.1 - Prob. 3MICh. 17.1 - What would you conclude if you obtained only blue...Ch. 17.1 - Why must introns be removed from eukaryotic DNA...Ch. 17.1 - Which plasmid is a shuttle vector? Why?Ch. 17.1 - In what ways does the BAC shown here differ from...Ch. 17.1 - Describe restriction enzymes, sticky ends, and...Ch. 17.1 - What is cDNA? Why is it necessary to generate cDNA...Ch. 17.1 - Prob. 3CC
Ch. 17.1 - Prob. 4CCCh. 17.1 - Prob. 5CCCh. 17.2 - Why, after three cycles, are the vast majority of...Ch. 17.2 - Briefly describe the polymerase chain reaction....Ch. 17.2 - Why is PCR used to detect infectious agents that...Ch. 17.2 - How would you use PCR to measure the concentration...Ch. 17.2 - Why is it possible to visualize a PCR product on...Ch. 17.2 - Prob. 5CCCh. 17.3 - Why are long fragments (e.g., 20,000 bp) of...Ch. 17.4 - What special considerations are necessary if one...Ch. 17.4 - Prob. 1CCCh. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - You are studying chemotaxis proteins in a newly...Ch. 17.5 - Prob. 1MICh. 17.5 - Prob. 1CCCh. 17.5 - Prob. 2CCCh. 17 - Which of the DNA molecules shown are recombinant?Ch. 17 - Prob. 1RCCh. 17 - Prob. 2RCCh. 17 - Prob. 3RCCh. 17 - Prob. 4RCCh. 17 - Prob. 5RCCh. 17 - Prob. 6RCCh. 17 - Prob. 1ALCh. 17 - Prob. 2ALCh. 17 - Suppose you transformed a plasmid vector carrying...Ch. 17 - You are interested in the activity and regulation...Ch. 17 - Prob. 5ALCh. 17 - Prob. 6ALCh. 17 - Prob. 7AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphologyis strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology? Also, describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon and why is it more likely that insertions or deletions will be more detrimental to a cell than point mutations?arrow_forwardSuppose that E. coli sustains a mutation in its gene for the lac operon depressor making the repressive ineffective. How would this mutation affect the bacterium's ability to catabolize lactose? Would the mute to strain have an advantage over the wild-type strain?arrow_forwardIn terms of the trp operon, differentiate between two normal bacterial cultures, one grown in a medium supplied with tryptophan and the other medium without tryptophan.arrow_forward
- What would happen if the operator sequence of the trp operon contained a mutation that prevented the repressor protein from binding to the operator? (Explain what would happen in both the presence and absence of tryptophan)arrow_forwardThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forwardAn E. coli strain where the crp gene that encodes the cAMP receptor protein (CRP), also known as the catabolite activator protein, has a mutation such that it is no longer active. In this case, the strain would no longer be able to (select all that are correct) A. Grow on minimal medium plus glucose B.Synthesize tryptophan C. Grow on minimal medium plus maltose D. Grow in a rich medium E. Grow on minimal medium plus lactosearrow_forward
- What would happen if the operator sequence of the lac operon contained a mutation that prevented the repressor protein from binding the operator? (Explain what would happen both in the presence and absence of lactose)arrow_forwardExplain the process of how the Lactose operon functions in the presence of lactose, glucose, both, and without lactose. Explain the process of how the Tryptophan operon functions in the presence of tryptophan and in the absence of tryptophan. What are the three types of horizontal gene transfer among prokaryotes? How do these three types of horizontal gene transfer work? What are restriction endonucleases, restriction fragments, & explain the general premise behind Recombinant DNA technology. Describe: STR’s, Mitotyping, & SNP’s in relation to DNA profiling What are Transgenic or Genetically Modified Organisms? Provide examples using herbicide tolerance and pest resistance.arrow_forwardLet’s suppose you have isolated a mutant strain of E. coli in which the lac operon is constitutively expressed. In other words, the operon is turned on in the presence or absence of lactose. One possibility is that the mutation mayblock the transcription of the lacI gene, thereby preventing the synthesis of lac repressor. A second possibility is that the mutation could alter the sequence of the lac operator in a way that prevents lac repressor from binding to the operator. How would you distinguish between these two possibilities?arrow_forward
- what is the lac operon ? what happens in terms of the lac operon when lactose is absent from the growth medium?!arrow_forwardRefer to the diagram of pUC18 (Fig.) to determine which restrictionenzymes you could use to insert a gene that would not interfere with ampicillin resistance or production of β-galactosidase by the host cell.arrow_forwardFor E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license