CAMPBELL BIOLOGY SFC PACKAGE >CUSTOM<
10th Edition
ISBN: 9781269941860
Author: Campbell
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17.4, Problem 4CC
Summary Introduction
To draw: Each codon on a messenger RNA (mRNA) that can bind to anticodon 3′-CGU-5′, tRNA molecule, and the amino acid it carries.
Concept introduction:
The genetic information of DNA is based on the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence each encodes. Whatis the effect of the mutation on the amino acid sequence?
Yes or no?
Is sequence of riboprobe identical to the mrna produced by gene in situ hybridization?
does column of purification in DNA allow it to flow while other molecules are trapped ?
Let’s practice making a strand of mRNA. Finish what we started:
DNA: T-A-C-T-T-A-C-A-C-G-T-C-A-A-C-G-T-G-C-C-T-T-A-G-C-C-A-T-TmRNA: A-U-GGo ahead and write out the complementary strand of mRNA above
Chapter 17 Solutions
CAMPBELL BIOLOGY SFC PACKAGE >CUSTOM<
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.1 - Prob. 4CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - Prob. 3CCCh. 17.3 - Prob. 1CCCh. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CC
Ch. 17.4 - What two processes ensure that the correct amino...Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - Prob. 4CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Which of the following is not true of a codon? (A)...Ch. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Which of the following is not true of RNA...Ch. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - Prob. 11TYUCh. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- VISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.arrow_forwardWHAT IF? In eukaryotic cells, mRNAs have been foundto have a circular arrangement in which proteins holdthe poly-A tail near the 5¿ cap. How might this increasetranslation efficiency?arrow_forwardVISUAL SKILLS A segment in the middle of an mRNA has thesequence 5¿-AGAGAACCGCGA-3¿. Using the codon table, translate thissequence, assuming the first three nucleotides are a codon.arrow_forward
- 1e) Give the sequence of every codon this tRNA, with the anticodon 5'AGG3', could base pair with (perfect and wobble matches), and name the amino acid coded for by each codon whose sequence you have written.arrow_forwardNeed help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How would the researchers determine which codon encoded each of these amino acids? 5’CGUCGUCGUCGUCGUCGUCGUCGU...3’arrow_forwardANWER FAST NO NEED FOR LONG EXPLANATION 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the deoxyribose is present in the 5’ end. Select one: True False 2. Not all missense mutations will lead to nonfunctional proteins. It all depends on where the substitution lies in the polypeptide chain and how it will affect protein folding and activity. Select one: True False 3.What component(s) is/are involved in transcription? a.Sigma factor b.RNA polymerase c.Promoter d.B and C e.All of the abovearrow_forward
- 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched by a tRNA anticodon that is its perfect complement), how many tRNAs would be required to service all of the threonine codons?arrow_forwardAfter viewing https://www.youtube.com/watch?v=qIwrhUrvX-k , relate the structure of the three RNA to their function in building of Polypeptide and point out the characteristics of a genetic code and their function in translation. 1. Messenger RNA 2. Transfer RNA 3. Ribosomal RNAarrow_forwardmRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon. -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.arrow_forward
- SCIENTIFIC INQUIRY Knowing that the genetic code is almostuniversal, a scientist uses molecular biological methods toinsert the human β-globin gene (shown in Figure 17.12) intobacterial cells, hoping the cells will express it and synthesizefunctional β-globin protein. Instead, the protein produced isnonfunctional and is found to contain many fewer amino acidsthan does β-globin made by a eukaryotic cell. Explain whyarrow_forwardi INSERTED make an insertion mutation by inserting a C after the 4th codon. Click show protein. Ø What effect does this mutation have on the polypeptide? Compare to the original polypeptide. Ø What is the resulting polypeptide: Ø Would this mutation allow the protein for perform the intended function? Why or why not? arrow_forward1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY