(a)
To determine: The number of proteins identified in the given project.
Introduction: The HPM (human proteome map) portal is an interactive
(b)
To determine: The number of fetal tissues analyzed in the project.
Introduction: Fetus is an unborn offspring of an organism. An embryo becomes a fetus in the 8th week of pregnancy. The fetal tissues are the tissues which are obtained from the fetus for experiments.
(c)
To determine: The search on the distribution of proteins encoded by a pathway from either fetal tissues, adult tissue, or both.
Introduction: A pathway is a series of an action of the molecule in the cells that lead to a change in the cell or results in the formation of a product. A pathway can trigger the assembly of molecules, proteins, or fats. The pathways can also turn a gene on or off.
Want to see the full answer?
Check out a sample textbook solutionChapter 21 Solutions
EBK CONCEPTS OF GENETICS
- Cystic fibrosis is genetic disease caused by mutations in the CFTR gene. The consequence of this is production of an abnormal transmembrane protein that is responsible for producing sweat, mucus, and digestive fluids. Explain in depth the correlation between the defective gene and the abnormal protein that is produced. Be sure to mention the process involved in protein production, whether or not those process(s) have occurred, and their end products. Provide details in your explanation and support your answer with facts from your textbook, research, and articles from scholarly journalsarrow_forwardInsulin is a peptide hormone encoded by the INS gene, which is on chromosome 11. Insulin is produced by pancreatic beta cells. A) Both the INS gene and insulin are examples of biological molecules that are polymers. What are the monomers and what is the polymer that make up the INS gene? What is the name of the monomers and polymer that make up insulin? B). How many copies of the INS gene are found in pancreatic beta cells? How many copies are found in other cell types, for example, cardiac muscle cells? C). Is mRNA for insulin produced in equal amounts in pancreatic beta cells and cardiac muscle cells? Why or why not? D) Diabetes mellitus can be caused by a dominant mutation in the INS gene, INS*C96Y. A healthy mother has an affect child. Give the genotype of the child at the INS locus, indicating the paternally and maternally inherited alleles.arrow_forwardYou hope to study a gene that codes for a neurotransmitter protein produced in human brain cells. You know the amino acid sequence of the protein. Explain how you might (a) identify what genes are expressed in a specific type of brain cell, (b) identify (and isolate) the neurotransmitter gene, (c) produce multiple copies of the gene for study, and (d) produce large quantities of the neurotransmitter for evaluation as a potential medication.arrow_forward
- Frog oocytes contain enormous numbers of cellular components such as ribosomes. Briefly explain how the oocyte precursor manages to transcribe enough rRNAs to assemble 100,000 times more ribosomes than normal in the relatively short time period of oocyte maturation.arrow_forwardGiven the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'arrow_forwardWhich of the examples of genetic testing below are prognostic tests? Which are diagnostic? (a) Individual sequencing (personal genomics) identifies a mutation associated with Alzheimer’s disease. (b) ASO testing determines that an individual is a carrier for the mutant b@globin allele (bS) found in sickle-cell anemia. (c) DNA sequencing of a breast tumor reveals mutations in the BRCA1 gene. (d) Genetic testing in a healthy teenager identifies an SNP correlated with autism. (e) An adult diagnosed with Asperger syndrome (AS) has a genetic test that reveals a SNP in the GABRB3 gene that is significantly more common in people with AS than the general population.arrow_forward
- The sequence below (A) was read from the autoradiogram (B). (A) 5' TGTACAACTTTTACTTAGGGCCGTGACACCTAAAG. 3' (B) Negative end ACGT Positive end C. Compare the sequence to the autoradiogram. How is the sequence read? Explain your ans d. Suppose that you want to express the correct protein product of an eukaryotic gene in a bacterial cell using a plasmid vector. What single sequence related factor must your consider in the cloning experiment?arrow_forward64. Embryonic stem (ES) cells differ from somatic stem cells in that ... a) ES cells can only be derived from early embryos, whereas somatic stem cells are present in adult tissues. b) ES cells retain the ability to renew themselves, whereas somatic stem cells do not. c) ES cells are pluripotent and can differentiate into any cell type in the developing embryo, whereas somatic stem cells are considered multipotent in that they produce a more limited number of differentiated cell types. d) a and c e) a, b and carrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forward
- Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forward(61) A 61-year old woman comes to the physician because of scarring acne vulgaris that has not been responsive to topical medication. Oral tetracycline is prescribed . Which of the following best explains the mechanism of action of this drug? (A) Blockage of DNA gyrase (B) Destruction of active transport membrane transport (C) Inhibition of aminoacyl-RNA binding to bacterial ribosomes (D) Interference with the action of peptidyl transferase (E) Interferance with translocation reactionarrow_forwardDetermine which statements could be used as evidence to support the argument that "DNA influences the proteins that are made" and which statements are just facts. [Select all that apply.] The HBB gene that makes beta-globin has several abnormal alleles, including HbS, HbC, and HbE. Sickle cell disease has been successfully treated using bone marrow transplantation in children and adults. The symptoms of sickle cell anemia may not appear in individuals who only carry one HbS allele, but are always apparent when both alleles are HbS. If oxygen is removed from red blood cells made by two HbS alleles, the cell will form a sickle shape.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education