![GENERAL,ORGANIC,+BIO.CHEM.-MINDTAP](https://www.bartleby.com/isbn_cover_images/9781305866966/9781305866966_largeCoverImage.gif)
GENERAL,ORGANIC,+BIO.CHEM.-MINDTAP
7th Edition
ISBN: 9781305866966
Author: STOKER
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 22, Problem 22.83EP
For each of the following DNA template strands, determine (1) the base sequence of the DNA informational strand and (2) the base sequence of the hnRNA synthesized using the DNA template strand. Specify base sequences in the 5′-to-3′ direction.
- a. 3′ TACGGC 5′
- b. 3′ CCATTA 5′
- c. 3′ ACATGG 5′
- d. 3′ ACGTAC 5′
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Trending nowThis is a popular solution!
![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Consider the following DNA strand with the following nucleotide sequence:
3’-ATATCAGAGAATATCA-5’
The nucleotide sequence of the complementary DNA strand is .
b. The nucleotide sequence of the antisense strand used in the transcription process is .
c. The nucleotide sequence of the mRNA strand produced after the transcription process is
2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol).
% A?
%C?
%G?
DNA methyltransferases are important regulators of epigenetic marks/memory. What is the role of a DNA methyltransferase during DNA replication?
A. They catalyze the addition of methyl groups to the new daughter strand using the parental strand's methylation pattern
B. They remove all methyl tags from all of the DNA restoring the totipotent state prior to mitosis
C. They catalyze the transfer of acetyl groups to certain nucleotides within the DNA after DNA replication has been completed
D. They inhibit the methylation of the new daughter strand so that only one strand remains methylated after replication
Give the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’
Chapter 22 Solutions
GENERAL,ORGANIC,+BIO.CHEM.-MINDTAP
Ch. 22.1 - Which of the following statements concerning...Ch. 22.1 - Which of the following statements concerning...Ch. 22.2 - Any given nucleotide in a nucleic acid contains a....Ch. 22.2 - How many different sugars and how many different...Ch. 22.2 - How many different heterocyclic bases that are...Ch. 22.3 - Which of the following is present in nucleotides...Ch. 22.3 - Which of the following is an incorrect statement...Ch. 22.3 - How many of the eight nucleic acid nucleotides are...Ch. 22.3 - Prob. 4QQCh. 22.4 - Prob. 1QQ
Ch. 22.4 - The backbone of a nucleic acid molecule involves...Ch. 22.4 - In a segment of a nucleic acid each nonterminal...Ch. 22.4 - Prob. 4QQCh. 22.4 - Prob. 5QQCh. 22.5 - Prob. 1QQCh. 22.5 - Prob. 2QQCh. 22.5 - Fifteen percent of the bases in a certain DNA...Ch. 22.5 - Which of the following is the correct...Ch. 22.6 - Replication of DNA produces two daughter molecules...Ch. 22.6 - In DNA replication the DNA double helix unwinds...Ch. 22.6 - Prob. 3QQCh. 22.6 - In DNA replication the unwinding of the DNA double...Ch. 22.6 - Prob. 5QQCh. 22.7 - Prob. 1QQCh. 22.7 - Prob. 2QQCh. 22.8 - Prob. 1QQCh. 22.8 - The m in the designation mRNA stands for a. mega...Ch. 22.8 - Prob. 3QQCh. 22.8 - Prob. 4QQCh. 22.9 - Prob. 1QQCh. 22.9 - Prob. 2QQCh. 22.9 - Prob. 3QQCh. 22.9 - Prob. 4QQCh. 22.9 - Prob. 5QQCh. 22.10 - Which of the following statements concerning...Ch. 22.10 - Prob. 2QQCh. 22.10 - Prob. 3QQCh. 22.10 - Prob. 4QQCh. 22.11 - Which of the following is an incorrect pairing of...Ch. 22.11 - Prob. 2QQCh. 22.11 - A tRNA molecule with the anticodon 5 AAG 3 will...Ch. 22.12 - Prob. 1QQCh. 22.12 - Which of the following events is not part of the...Ch. 22.12 - The number of codon binding sites in an...Ch. 22.12 - Prob. 4QQCh. 22.12 - Prob. 5QQCh. 22.13 - Which of the following describes the effect of a...Ch. 22.13 - Which of the following describes the effect of a...Ch. 22.13 - Which of the following statements applies to both...Ch. 22.14 - Which of the following statements about a virus is...Ch. 22.14 - Prob. 2QQCh. 22.15 - Prob. 1QQCh. 22.15 - Prob. 2QQCh. 22.15 - The role of E. coli plasmids in obtaining rDNA is...Ch. 22.15 - Prob. 4QQCh. 22.15 - Prob. 5QQCh. 22.16 - Prob. 1QQCh. 22.16 - Each cycle of the polymerase chain reaction a....Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following pentoses is...Ch. 22 - Indicate whether each of the pentoses in Problem...Ch. 22 - With the help of Figure 22-2, identify each of the...Ch. 22 - With the help of Figure 22-2, identify each of the...Ch. 22 - With the help of Figure 22-2, what is the...Ch. 22 - With the help of Figure 22-2, what is the...Ch. 22 - With the help of Figure 22-2, indicate whether...Ch. 22 - With the help of Figure 22-2, indicate whether...Ch. 22 - How many different choices are there for each of...Ch. 22 - How many different choices are there for each of...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - What is the name of the nucleoside that contains...Ch. 22 - What is the name of the nucleoside that contains...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following is a DNA...Ch. 22 - Prob. 22.20EPCh. 22 - Nucleotides containing ribose, thymine, and...Ch. 22 - Prob. 22.22EPCh. 22 - What nitrogen-containing base and what sugar are...Ch. 22 - What nitrogen-containing base and what sugar are...Ch. 22 - What is the name of each of the nucleotides in...Ch. 22 - What is the name of each of the nucleotides in...Ch. 22 - Consider the following nucleotide. a. What is the...Ch. 22 - Consider the following nucleotide. a. What is the...Ch. 22 - Indicate whether each of the following is (1) a...Ch. 22 - Indicate whether each of the following is (1) a...Ch. 22 - For the trinucleotide 5 GCA 3 a. How many...Ch. 22 - For the trinucleotide 5 UCG 3 a. How many...Ch. 22 - Is the trinucleotide in Problem 22-31 found only...Ch. 22 - Is the trinucleotide in Problem 22-32 found only...Ch. 22 - In the lengthening of a polynucleotide chain,...Ch. 22 - In the lengthening of a polynucleotide chain,...Ch. 22 - Draw the structure of the RNA dinucleotide 5 UG 3.Ch. 22 - Draw the structure of the DNA dinucleotide 5 TA 3.Ch. 22 - For the trinucleotide 5 T-G-A 3 a. How many...Ch. 22 - For the trinucleotide 5 U-C-G 3 a. How many...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following are...Ch. 22 - Indicate whether each of the following are...Ch. 22 - The base content of a particular DNA molecule is...Ch. 22 - The base content of a particular DNA molecule is...Ch. 22 - What structural consideration prevents the bases A...Ch. 22 - What structural consideration prevents the bases C...Ch. 22 - The base composition for one of the strands of a...Ch. 22 - The base composition for one of the strands of a...Ch. 22 - Convert each of the following 3-to-5 DNA base...Ch. 22 - Convert each of the following 3-to-5 DNA base...Ch. 22 - Using the concept of complementary base pairing,...Ch. 22 - Using the concept of complementary base pairing,...Ch. 22 - For the DNA segment 5 TTGCAC 3 how many of each of...Ch. 22 - For the DNA segment 5 TAGATG 3 how many of each of...Ch. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - In the replication of a DNA molecule, two daughter...Ch. 22 - In the replication of a DNA molecule, two daughter...Ch. 22 - How does the synthesis of a daughter DNA strand...Ch. 22 - Prob. 22.62EPCh. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.65EPCh. 22 - Prob. 22.66EPCh. 22 - Suppose that 28% of the nucleotides in a DNA...Ch. 22 - Suppose that 30% of the nucleotides in a DNA...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.70EPCh. 22 - Prob. 22.71EPCh. 22 - Prob. 22.72EPCh. 22 - Prob. 22.73EPCh. 22 - Prob. 22.74EPCh. 22 - Indicate whether the predominant cellular location...Ch. 22 - Indicate whether the predominant cellular location...Ch. 22 - Indicate whether each of the following situations...Ch. 22 - Indicate whether each of the following processes...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.81EPCh. 22 - Prob. 22.82EPCh. 22 - For each of the following DNA template strands,...Ch. 22 - Prob. 22.84EPCh. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.86EPCh. 22 - Prob. 22.87EPCh. 22 - Prob. 22.88EPCh. 22 - What mRNA base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.90EPCh. 22 - Prob. 22.91EPCh. 22 - What mRNA base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.93EPCh. 22 - Prob. 22.94EPCh. 22 - Prob. 22.95EPCh. 22 - An hnRNA molecule contains three exons, with the...Ch. 22 - Prob. 22.97EPCh. 22 - Indicate whether each of the following...Ch. 22 - Prob. 22.99EPCh. 22 - Prob. 22.100EPCh. 22 - Prob. 22.101EPCh. 22 - Prob. 22.102EPCh. 22 - Prob. 22.103EPCh. 22 - Prob. 22.104EPCh. 22 - Explain why the base sequence ATC could not be a...Ch. 22 - Explain why the base sequence AGAC could not be a...Ch. 22 - Predict the sequence of amino acids coded by the...Ch. 22 - Prob. 22.108EPCh. 22 - Prob. 22.109EPCh. 22 - Prob. 22.110EPCh. 22 - Determine each of the following items using the...Ch. 22 - Determine each of the following items using the...Ch. 22 - Prob. 22.113EPCh. 22 - Prob. 22.114EPCh. 22 - Prob. 22.115EPCh. 22 - Prob. 22.116EPCh. 22 - Prob. 22.117EPCh. 22 - Prob. 22.118EPCh. 22 - Prob. 22.119EPCh. 22 - Which amino acid will a tRNA molecule be carrying...Ch. 22 - Prob. 22.121EPCh. 22 - Prob. 22.122EPCh. 22 - Prob. 22.123EPCh. 22 - The following is a base sequence for an exon...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.126EPCh. 22 - Prob. 22.127EPCh. 22 - Prob. 22.128EPCh. 22 - Prob. 22.129EPCh. 22 - Prob. 22.130EPCh. 22 - Prob. 22.131EPCh. 22 - Prob. 22.132EPCh. 22 - Prob. 22.133EPCh. 22 - Prob. 22.134EPCh. 22 - Consider the following mRNA base sequence 5CUUCAG3...Ch. 22 - Consider the following mRNA base sequence 5ACCCAC3...Ch. 22 - Consider the following DNA base sequence 3TTAATA5...Ch. 22 - Consider the following DNA base sequence 3TATCGG5...Ch. 22 - The DNA template strand segment 3TTCAAACCGTAC5...Ch. 22 - Prob. 22.140EPCh. 22 - Prob. 22.141EPCh. 22 - Prob. 22.142EPCh. 22 - Prob. 22.143EPCh. 22 - Prob. 22.144EPCh. 22 - Prob. 22.145EPCh. 22 - Prob. 22.146EPCh. 22 - Prob. 22.147EPCh. 22 - Prob. 22.148EPCh. 22 - Prob. 22.149EPCh. 22 - Prob. 22.150EPCh. 22 - Prob. 22.151EPCh. 22 - Prob. 22.152EPCh. 22 - Prob. 22.153EPCh. 22 - Prob. 22.154EP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.Similar questions
- The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forwardBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forward
- Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forwardAnswer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forward
- Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forwarda. This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and the gel is stained with ethidium bromide. Draw a picture of the bands that will appear on the gel. b. If a mutation that alters EcoRI site 1 occurs in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? c. If mutations that alter EcoRI sites 1 and 2 occur in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? d. If 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one that you drew in part a? e. If 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one that you drew in part a?arrow_forwardwhich of the following sequences would most likely be able to bind a cyclic amp dna binding protein? (only one strand is shown but assume dna is double stranded) a. 5' atagtcatagtc 3' b. 5' atcggtctcgat 3' c. 5' gctctagcgagc 3' d. 5' atagtaatgata 3'arrow_forward
- The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forwarda) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?arrow_forwardIn the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Nucleic acids - DNA and RNA structure; Author: MEDSimplified;https://www.youtube.com/watch?v=0lZRAShqft0;License: Standard YouTube License, CC-BY