Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 22, Problem 7EQ
Summary Introduction
To review:
Reverse genetics is the opposite of conventional genetic study of gene function.
Introduction:
The conventional study of gene function includes identification of gene because of an altered
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is the first step in quantifying the relative amounts of mRNA in different tissues? Would this method be useful in determining which immune system genes might be over-expressed in severe Covid cases? Why or why not?
Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells?
One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in…
In the bacteriophage T7 system used to express recombinant proteins, the gene of interest is fused to T7 promoter and T7 RNA polymerase is separately cloned into the same cell. What is the main reason this system uses T7 RNA polymerase instead of relying on the bacterial RNA polymerase?
To restrict the expression of bacterial protein expression
To enhance the amount of recombinant protein expression
To enhance the expression of bacterial protein expression
To restrict the amount of recombinant protein expression
To enable the expression of T7 viral protein expression
What is a gene knockout? Is an animal or plant with a gene knockout a heterozygote or homozygote? What might you conclude if a gene knockout does not have a phenotypic effect?
Chapter 22 Solutions
Genetics: Analysis and Principles
Ch. 22.1 - 1. Which of the following uses of microorganisms...Ch. 22.1 - Prob. 2COMQCh. 22.1 - Prob. 3COMQCh. 22.2 - When a cloned gene is inserted into a noncritical...Ch. 22.2 - Prob. 2COMQCh. 22.3 - Prob. 1COMQCh. 22.3 - Prob. 2COMQCh. 22.4 - Prob. 1COMQCh. 22.4 - Prob. 2COMQCh. 22.5 - A means of introducing a cloned gene into cells...
Ch. 22.5 - 2. Which of the following best describes the...Ch. 22 - 1. What is a recombinant microorganism? Discuss...Ch. 22 - Prob. 2CONQCh. 22 - 3. What is bioremediation? What is the difference...Ch. 22 - Prob. 4CONQCh. 22 - Prob. 5CONQCh. 22 - Prob. 6CONQCh. 22 - 7. What is a transgenic organism? Describe three...Ch. 22 - Prob. 8CONQCh. 22 - Explain the difference between gene modification...Ch. 22 - As described inChapter 5, not all inherited traits...Ch. 22 - Prob. 11CONQCh. 22 - 12. Discuss the concerns that some people have...Ch. 22 - Prob. 1EQCh. 22 - 2. Bacillus thuringiensis makes toxins that kill...Ch. 22 - Prob. 3EQCh. 22 - Prob. 4EQCh. 22 - Prob. 5EQCh. 22 - What is a gene knockout? Is an animal or plant...Ch. 22 - Prob. 7EQCh. 22 - Evidence [see P. G. Shiels, A. J. Kind, K. H....Ch. 22 - Prob. 9EQCh. 22 - 10. What is reproductive cloning? Are identical...Ch. 22 - Researchers have identified a gene in humans that...Ch. 22 - Treatment of adenosine deaminase (ADA) deficiency...Ch. 22 - Several research studies are under way that...Ch. 22 - Prob. 1QSDCCh. 22 - 2. A commercially available strain of P....Ch. 22 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Bacterial glucuronidase converts a colorless substance called X-Gluc into a bright blue indigo pigment. The gene for glucuronidase also works in plants if given a plant promoter region. How would you use this gene as a reporter gene to find the tissues in which a plant gene that you have just cloned is normally active? (Assume that X-Gluc is easily taken up by the plant tissues.)arrow_forwardCould quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in immature red blood cells is a reliable indicator that more alpha hemoglobin protein will be made in those cells?arrow_forwardYou are interested in studying a novel gene that appears to be involved in cancer. There is no information about the function of this gene. What would you do to obtain the cDNA for this gene? How would you express this gene and what expression systems might you utilize to study its function and why? How would determine the subcellular localization of this gene in eukaryotic cells? What are alternative methods in case one doesn't work? How would you purify and determine the 3-dimensional structure of this protein?arrow_forward
- On the image, you can see the results of a DNA microarray used for cancer prognosis, where tissue samples from healthy and cancerous tissues were analyzed. cDNA from healthy cells and cancer cells were labeled with green and red fluorescence, respectively, mixed equally, and hybridized with the chip. It is known that gene A is more highly expressed in breast cancer type I, while genes B and C have lower expression in type II, which is highly aggressive. Based on the gene expression levels shown in the image, the cancer sample does not correspond to either type I or type II breast cancer, why is that?arrow_forwardThe sequencing of entire genomes has made it possible to examine the level of gene expression in a particular cell or tissue by using oligonucleotide probes to assess the mRNA expression level from a particular gene. This is done most effectively through the use of what experimental technique?arrow_forwardGene expression can be disrupted by techniques such as homologous recombination and RNA interference. What is the functional difference between these two methods in terms of the ultimate effect on gene expression? Why might homologous recombination or an alternative genome-editing method (e.g., CRISPR/Cas9) be preferred over RNA interference?arrow_forward
- The amino acid asparagine is synthesized from aspartic acid by the enzyme asparagine synthetase (AS). In the previous problem you proposed a model for how this gene could be regulated. Suppose that you carry out an experiment to test your model. To do this you cut out the regulatory sequences upstream of the gene and fuse it to a gene for green fluorescent protein (GFP). Now you can visually observe when the gene is activated. You insert this engineered gene into a host cell and look for GFP expression. You discover some mutants that have different expression levels of GFP and call them GFP1- and GFP2-. The expression levels of GFP are given below. Cell GFP expression Wild type 100 GFP1- 50 GFP2- 0 Propose an explanation for these results based on your model. In other words, what was mutated and how? This answer should include whether the mutation is (view links for more information): dominant or recessive https://www.ncbi.nlm.nih.gov/books/NBK21578/#A1877 in a cis…arrow_forwardThe amino acid asparagine is synthesized from aspartic acid by the enzyme asparagine synthetase (AS). In the previous problem you proposed a model for how this gene could be regulated. Suppose that you carry out an experiment to test your model. To do this you cut out the regulatory sequences upstream of the gene and fuse it to a gene for green fluorescent protein (GFP). Now you can visually observe when the gene is activated. You insert this engineered gene into a host cell and look for GFP expression. You discover some mutants that have different expression levels of GFP and call them GFP1- and GFP2-. The expression levels of GFP are given below. Cell GFP expression Wild type 100 GFP1- 50 GFP2- 0 Propose an explanation for these results based on your model. In other words, what was mutated and how? Your answer should include whether the mutation is (see links for more information): dominant or recessive https://www.ncbi.nlm.nih.gov/books/NBK21578/#A1877…arrow_forwardAt the molecular level, how do you think a gain-of-function mutation in a developmental gene might cause it to be expressed in the wrong place or at the wrong time? Explain what type of DNA sequence would be altered.arrow_forward
- The ability to selectively modify the genome in the mouse has revolutionized mouse genetics. Outline the procedure for generating a knockout mouse at a specific genetic locus. How can the loxP-Cre system be used to conditionally knock out a gene? What is an important medical application of knockout mice?arrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forwardScientists carried out a microarray analysis to compare the gene expression of normal liver cells to that of cancer cells from a person with liver cancer. The scientists labeled the cDNA from the normal pancreatic cells with green fluorescent nucleotides. They labeled the cDNA from the cancer cells with red fluorescent nucleotides. The two cDNAs were mixed and allowed to hybridize to a microarray. Normal liver cells =Green Cancer cells =Red The DNA in that spot is the same in cancer cells and normal cells =Yellow Question: Gene alpha is turned on in all liver cells. In the cancer sample there is a nonsense mutation in this gene such that the protein terminates translation early but transcription is unaffected. What color is the alpha gene spot on the microarray? Answer: Yellow please explain why is the answer yellow?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
An Introduction to the Human Genome | HMX Genetics; Author: Harvard University;https://www.youtube.com/watch?v=jEJp7B6u_dY;License: Standard Youtube License