Genetics: Analysis and Principles
5th Edition
ISBN: 9780073525341
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 25, Problem 6CONQ
Summary Introduction
To review:
The type of gene that is defective in the mutant larvae of Drosophila.
Introduction:
A defect in various segmentation genes results in the formation of different types of larva in Drosophila. The three types of segmentation genes include gap gene, segment-polarity gene, or pair-rule gene, which on mutation causes the deletion of various segments from the larva of Drosophila. These genes are also responsible for dividing the larva into many segments.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The locations of six deletions have been mapped to a Drosophila chromosome, as shown in the following deletion map. Recessive mutations a, b, c, d, e, and f are known to be located in the same region as the deletions, but the order of the mutations on the chromosome is not known.
The locations of six deletions have been mapped to a Drosophila chromosome, as shown in the following deletion map. Recessive mutations a, b, c, d, e, and f are known to be located in the same region as the deletions, but the order of the mutations on the chromosome is not known. (refer image for contination )
Suppose a researcher has three different Drosophila strains that have mutations in the bicoid gene called bicoid-A, bicoid-B, and bicoid-C; the wild type is designated bicoid +. To study these mutations,
phenotypically normal female flies that are homozygous for the given bicoid mutation were obtained, and their oocytes were analyzed using a Northern blot to determine the size and/or amount of the bicoid
mRNA and in situ hybridization to determine the bicoid mRNA location within the oocyte. A wild-type strain was also analyzed as a control. In both cases, the probe was complementary to the bicoid mRNA and
the results are shown below. (Anterior is on the left; posterior is on the right.)
Northern blot
1
2
-
3 4
In situ hybridization
Wild type
Lane 1. Wild type (bicoid*)
Lane 2. bicoid-A
Lane 3. bicoid-B
Lane 4. bicoid-C
bicoid-B
bicoid-A
bicoid-C
Which mutation is likely to cause the embryo to develop two "anterior" ends?
bicoid-B
Obicoid-A
bicoid-C
Chapter 25 Solutions
Genetics: Analysis and Principles
Ch. 25.1 - Prob. 1COMQCh. 25.1 - Prob. 2COMQCh. 25.1 - Which of the following is the correct order for...Ch. 25.2 - Prob. 1COMQCh. 25.2 - Prob. 2COMQCh. 25.2 - Prob. 3COMQCh. 25.2 - Prob. 4COMQCh. 25.3 - Prob. 1COMQCh. 25.3 - Prob. 2COMQCh. 25.3 - 3. Myogenic bHLH proteins are ___________ that...
Ch. 25.4 - Prob. 1COMQCh. 25.4 - Prob. 2COMQCh. 25.5 - 1. A key event that initially determines female or...Ch. 25.5 - Prob. 2COMQCh. 25 - 1. What four types of cellular processes must...Ch. 25 - Prob. 2CONQCh. 25 - Prob. 3CONQCh. 25 - 4. Which of the following statement(s) is/are true...Ch. 25 - Discuss the morphological differences between the...Ch. 25 - Prob. 6CONQCh. 25 - Explain what a morphogen is, and describe how it...Ch. 25 - 8. What is positional information? Discuss three...Ch. 25 - Prob. 9CONQCh. 25 - Prob. 10CONQCh. 25 - 11. Describe the function of the Bicoid protein....Ch. 25 - With regard to development, what are the roles of...Ch. 25 - Discuss the role of homeotic genes in development....Ch. 25 - Describe the molecular features of the homeobox...Ch. 25 - What would you predict to be the phenotype of...Ch. 25 - Prob. 16CONQCh. 25 - If a mutation in a homeotic gene produced the...Ch. 25 - 18. Explain how loss-of-function mutations in the...Ch. 25 - What is the difference between a maternal-effect...Ch. 25 - Prob. 20CONQCh. 25 - Prob. 21CONQCh. 25 - Prob. 22CONQCh. 25 - 23. Discuss the similarities and differences...Ch. 25 - 24. What is cell differentiation? Discuss the role...Ch. 25 - Prob. 25CONQCh. 25 - What is a totipotent cell? In each of the...Ch. 25 - 27. What is a meristem? Explain the role of...Ch. 25 - Prob. 28CONQCh. 25 - Predict the phenotypic consequences of each of the...Ch. 25 - 30. Explain how alternative splicing affects sex...Ch. 25 - Prob. 1EQCh. 25 - Compare and contrast the experimental advantages...Ch. 25 - 3. What is meant by the term cell fate? What is a...Ch. 25 - 4. Explain why a cell lineage diagram is necessary...Ch. 25 - Explain the rationale behind the use of the bag of...Ch. 25 - Prob. 6EQCh. 25 - Take a look at question 2 in More Genetic TIPS...Ch. 25 - All of the homeotic genes inDrosophilahave been...Ch. 25 - Prob. 9EQCh. 25 - wo techniques commonly used to study the...Ch. 25 - Prob. 11EQCh. 25 - Prob. 12EQCh. 25 - 13. Another way to study the role of proteins...Ch. 25 - 14. Why have geneticists used reverse genetics to...Ch. 25 - Prob. 1QSDCCh. 25 - Prob. 2QSDCCh. 25 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The normal sequence of markers on a certain Drosophila chromosome is ABCDE*FGHIJK, where the asterisk represents the centromere. Some flies were isolated with a chromosome aberration that has the following structure: ABCDE*FIJK . This represents a O a) deletion of GH segment O b) inversion of GH segment O c) deletion O d) deletion of centromerearrow_forwardA maternal effect gene in Drosophila, called torso, is found as a recessive allele that prevents the correct development of anterior- and posterior-most structures. A wild-type (homozygous) male is crossed to a female of unknown genotype. This mating produces 100% larva that are missing their anterior- and posterior-most structures and therefore die during early development. What is the genotype and phenotype of the female fly in this cross? What are the genotypes and phenotypes of the female fly’s parents? Show COMPLETE cross.arrow_forwardYou are interested in studying position effect variegation in Drosophila using the chromosome depicted below: Deactivation of the w+ gene gives a white eye phenotype and deactivation of the rst+ gene gives a rough eye phenotype; the normal phenotypes are red and smooth. Because the rst+ and w+ genes have now been placed close to a heterochromatic domain, some sections (or sectors) of the eye display mutant phenotypes due to gene deactivation while others display the normal, wild type phenotype. Which phenotype would you not expect to see rst w Inverted X chromosome white smooth eye sectors white rough eye sectors red smooth eye sectors red rough eye sectorsarrow_forward
- Consider the following variations in Drosophila melanogaster, relative to the wild-type: White eyes are a recessive trait—the gene of which is found in Chromosome I (X). Vestigial wings are a recessive trait—the gene of which is found in Chromosome II. Aristapedia is a dominant trait—the gene of which is found in Chromosome III. Being homozygous for this condition is lethal. Cross the following mutant females with a wild-type (homozygous) male. Show the Punnett square and obtain the genotypic and phenotypic ratios of the first filial generation (F1). Female with white eyes Q4: Show the Punnett squares and obtain the genotypic and phenotypic ratios of the first filial generation (F1) and second filial generation (F2) of the following crosses. Note: The F2 generation can be obtained by crossing one male and one female from the F1 generation. Female with white eyes and vestigial wings and wild-type malearrow_forwardUsing Drosophila notation: A.) Diagram the genotype of a female fly that is recessive for apterus (ap, chromosome 2), heterozygous wild-type for black (b, chromosome 2), recessive for forked (f, x-chromosome), and homozygous wild type for rosy (ry, chromosome 3). B.) Diagram the genotype of a male fly that is heterozygous for clot (ct) eyes (an autosomal gene) and has yellow (y) body color (x-linked gene).arrow_forwardFor the first experiment ever on Drosophila mutations. Answer the following questions. a. What is the title of the first published paper explained the experiment and what is the name of the Author? b. What is the first mutation discovered in Drosophila? c. Explain the changes in the Drosophila yellow mutant (Y)compared to wild type.arrow_forward
- In Drosophila, one of the genes controlling wing length is located on the X chromosome. A recessive mutant allele of this gene makes the wings miniature—hence, its symbol m; the wild-type allele of this gene, m_, makes the wings long. One of the genes controlling eye color is located on an autosome. A recessive mutant allele of this gene makes the eyes brown—hence, its symbol bw; the wildtype allele of this gene, bw_, makes the eyes red. Miniature-winged, red-eyed females from one true-breeding strain were crossed to normal-winged, brown-eyed males from another true-breeding strain. 1. Predict the phenotypes of the F1 flies. 2. If these flies are intercrossed with one another, what phenotypes will appear in the F2, and in what proportions?arrow_forwardCertain genes determine sex, fertility, and viability in Drosophila, and mutations in these genes affect the two sexes differently. Classify the descriptions below based on their occurrence in XY or XX flies. Some descriptions may be used in both categories. The expressed form of Dsx activates maleness genes and represses femaleness genes. XY XX Null mutations in the dsx gene result in an intersex phenotype. Loss-of-function mutations in the tra gene have no effect on phenotype. Sxl is expressed in early embryogenesis from the establishment promoter. Flies that produce Fru-M in brain cells from a transgene perform a mating dance and specifically court females. Loss-of-function mutations in the fru gene result in flies who court both males and females. Sxl regulates splicing of its own RNA to produce a functional protein. The expressed form of Dsx activates femaleness genes and represses maleness genes. Loss-of-function mutations in the Sxl gene have no effect on phenotype. Resetarrow_forwardA maternal effect gene in Drosophila, called torso, is found as a recessive allele that prevents the correct development of anterior- and posterior-most structures. A wild-type (homozygous) male iscrossed to a female of unknown genotype. This mating produces 100% larva that are missing theiranterior- and posterior-most structures and therefore die during early development. What is the genotype and phenotype of the female fly in this cross? What are the genotypes andphenotypes of the female fly’s parents? Show COMPLETE cross. Maternal genotype:Paternal genotype:F1 genotype:F1 phenotype:arrow_forward
- In drosophila, a recessive mutation (m-) of a maternal effect gene results in an abnormal phenotype wherein homozygous (m-m-) females produce eggs that cannot support embryonic development. Homozygous (m-m-) males, however, can still produce viable sperm. Using m+ to denote a normal gene, determine the genotypes and phenotypes of the F1s produce by a cross between a heterozygous female and a recessive male. From the offspring, backcross the recessive female with the paternal strain. 1. What are the genotypes and phenotypes of the F2s? 2. If m-m- females produce useless eggs, then how are m-m- produced?arrow_forwardIn drosophila, a recessive mutation (m-) of a maternal effect gene results in an abnormal phenotype wherein homozygous (m-m-) females produce eggs that cannot support embryonic development. Homozygous (m-m-) males, however, can still produce viable sperm. Using m+ to denote a normal gene, determine the genotypes and phenotypes of the F1s produce by a cross between a heterozygous female and a recessive male. From the offspring, backcross the recessive female with the paternal strain. What are the genotypes and phenotypes of the F2s? Show COMPLETE cross for both cases. If m-m- females produce useless eggs, then how are m-m- produced?arrow_forwardBelow are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c.The fourth sequence shown above has two mutational differences from the first sequence. Specifically, the third codon is TTG versus CTC in the first sequence. These two codons are two mutational steps away from each other. Supposing that the CTC sequence gave rise to the TTG sequence, do you think it is more likely that the one-difference intermediate was TTC or CTG? d. In general, synonymous polymorphisms tend to be more common than nonsynonymous…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY