Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
12th Edition
ISBN: 9780134811390
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 26, Problem 4PDQ
The genetic difference between two Drosophila species, D. heteroneura and D. silvestris, as measured by
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
To understand the genetic basis of locomotion in the diploid nematode Caenorhabditis elegans, recessive mutations were obtained, all making the worm “wiggle” ineffectually instead of moving with its usual smooth gliding motion. These mutations presumably affect the nervous or muscle systems. Twelve homozygous mutants were intercrossed, and the F1 hybrids were examined to see if they wiggled. The results were as follows, where a plus sign means that the F1 hybrid was wild type (gliding) and “w” means that the hybrid wiggled.a. Explain what this experiment was designed to test. b. Use this reasoning to assign genotypes to all 12 mutants. c. Explain why the phenotype of the F1 hybrids between mutants 1 and 2 differed from that of the hybrids between mutants 1 and 5
The tiny frog Paedophryne amauensis was discovered by researchers purposefully searching for the source of an unusual sound, but sometimes similarity between two species can lead scientists to accidental discoveries. A previously unknown species of wild cat was inadvertently discovered by researchers who were sequencing the DNA of a house cat–sized South American wild cat called the tigrina. The DNA analysis revealed that many alleles found in the supposed tigrinas living in northeastern Brazil are not shared with other tigrinas. This finding suggested that the northeastern cats do not interbreed with other tigrinas and are therefore a different species. What prevents the two species from interbreeding?
You join a project where the team is working on mapping three genes of a plant-like organism. The group is interested in three traits: flower color
(red or purple; encoded by gene Color [C]), leaf texture (smooth or hairy; encoded by gene Texture [T]), and petal veins (present or absent;
encoded by gene Vein [V]).
One of the extraterrestrial geneticists (Dr. Jerry) hypothesizes that the genes for these traits are each on separate chromosomes that sort
independently. You hypothesize that the genes for these traits are completely linked on the same chromosome and that they are all inherited
together.
1.You cross 100 plants that are true-breeding for red flowers, hairy leaves, and petal veins (P1) with 100 plants that are true-breeding for purple
flowers, smooth leaves, and no petal veins (P2). 500 plants of the F1 generation all have red flowers, hairy leaves, and petal veins. What does
this tell you about the linkage between these genes?
P1
P2
Purple Petals
Smooth Leaves
Veins Absent…
Chapter 26 Solutions
Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
Ch. 26 - The ability to taste the compound...Ch. 26 - Determine whether the following two sets of data...Ch. 26 - If the albino phenotype occurs in 1/10,000...Ch. 26 - A prospective groom, who is unaffected, has a...Ch. 26 - In a region of Quebec, Canada, 1 in 22 people are...Ch. 26 - Critics argue that a uniform panel of disorders...Ch. 26 - Others argue that the current testing system...Ch. 26 - HOW DO WE KNOW? Population geneticists study...Ch. 26 - CONCEPT QUESTION Read the Chapter Concepts list on...Ch. 26 - Price et al. [(1999).J. Bacteriol181:2358-2362)...
Ch. 26 - The genetic difference between two Drosophila...Ch. 26 - The use of nucleotide sequence data to measure...Ch. 26 - Prob. 6PDQCh. 26 - What must be assumed in order to validate the...Ch. 26 - In a population where only the total number of...Ch. 26 - If 4 percent of a population in equilibrium...Ch. 26 - Consider a population in which the frequency of...Ch. 26 - If the initial allele frequencies are p = 0.5 and...Ch. 26 - Under what circumstances might a lethal dominant...Ch. 26 - Assume that a recessive autosomal disorder occurs...Ch. 26 - One of the first Mendelian traits identified in...Ch. 26 - Describe how populations with substantial genetic...Ch. 26 - Achondroplasia is a dominant trait that causes a...Ch. 26 - Prob. 17PDQCh. 26 - Prob. 18PDQCh. 26 - A botanist studying water lilies in an isolated...Ch. 26 - A farmer plants transgenic Bt corn that is...Ch. 26 - In an isolated population of 50 desert bighorn...Ch. 26 - To increase genetic diversity in the bighorn sheep...Ch. 26 - What genetic changes take place during speciation?Ch. 26 - Some critics have warned that the use of gene...Ch. 26 - Prob. 25PDQCh. 26 - What are the two groups of reproductive isolating...Ch. 26 - A form of dwarfism known as Ellisvan Creveld...Ch. 26 - The original source of new alleles, upon which...Ch. 26 - A number of comparisons of nucleotide sequences...Ch. 26 - Shown below are two homologous lengths of the...Ch. 26 - Recent reconstructions of evolutionary history are...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The fruit fly Drosophila melanogaster has about 2 x 10^8 base pairs of DNA per haploid genome, of which about 75% in nonrepeated DNA. The DNA is distributed among four pairs of homologous chromosomes, which have a total of about 5,000 visible bands when in polytene forms in the salivary gland. The number of genes initially estimated from mutational studies was also about 5,000 but recent DNA sequencing studies suggest that the gene number may be somewhat higher. a. Why was it tempting to speculate that each band corresponds to a single gene? What does this suggest about the number of different proteins Drosophila can make? Does that seem like a reasonable number to you? b. Assuming all the nonrepeated DNA is uniformly distributed in the chromosomes, how much nonrepeated DNA (in base pairs) is there in average band?arrow_forwardInterested in exploring the genetic pathways that lead to neurological issues, you want to see if recessive mutations which generate too many neurons (tm) in flies - which many causes autistic like symptoms are in the same gene as mutations that generate too few neurons (tf) - intellectual diabilities. You cross a true-breeding homozygous tm/tm fly to a homozygous too few neuron fly tf/tf. What phenotype in the progeny would tell these mutations are in different genes?arrow_forwardBecause offspring inherit the mitochondrial genome only from the mother, evolutionarily the mitochondrial genome in males encounters a dead end. The mitochondrial genome in males has no significant impact on the genetic information of future generations. Scientists have proposed that this can result in an accumulation of mutations that have a negative impact on genetic fitness of males but not females. Experiments with Drosophila support this possibility. What experimental data or evidence would you want to evaluate or consider to determine if an accumulation of mtDNA mutations negatively impacts the fitness of males of any species?arrow_forward
- You are working in the lab with strains of Drosophila that have either normal legs or abnormally short legs and you are studying the gene responsible. You know that normal legs are dominant to short legs. You come across a misplaced fly with normal legs, but you are not sure of his genetic background and you want to keep him in your experiments. (Without doing a molecular analysis), How could you figure out whether he was heterozygous or homozygous for the leg gene that you are studying? (Describe what you would do and how the results would answer the question.) What is the procedure you described above called?arrow_forwardThe easily observed external structures in insects, such as different pairs of legs, antennae, and wings form from imaginal discs. a.) How is the identity of the different Drosophila imaginal discs established in the embryo—for example, how is it determined whether a disc will form a wing, a leg, or some other structure? b.) Dominant mutants in the gene Antennapedia result in fore legs forming in the location where antennae are expected. How does this mutant phenotype illustrate your response to Part a?arrow_forwardYou are interested if whether several genes of a certain species of beetle assort independently. So, you conduct several generations of matings, and after you have collected all your data, you are ready to analyze your results. You conduct a Chi2 test to test your hypothesis. You have 6 groups and calculate a Chi? = 13.22. Given that the critical value at 0.05 level of %3D significance = 11.07 at df = 5, %3D (A) State your null hypothesis. (B) Should you accept or reject your null hypothesis? (C) Why did you arrive your decision in (B)?arrow_forward
- I have seen that this was answered as C, Why is the answer C, how is that not evidence of it being genetic? Shouldnt it be none of the above? Question: Of the following, which supports the idea that alcoholism has no genetic or a low genetic component? a) Some strains of mice select alcohol over water 75% of the time, whereas others shun alcohol. b) The concordance value is 55% for MZ twins and 28% for DZ twins. c) Biological sons of alcoholic men who have been adopted have a rate of alcoholism more like that of their adoptive fathers. d) There is a 20% to 25% risk of alcoholism in the sons of alcoholic men. e) None of these.arrow_forwardIn the nematode C. elegans, homozygosity for the e mutant allele causes an extreme "uncoordinated" phenotype, where the worm completely loses its ability to move. Examination of 100 individuals with genotype e/e reveals that 60 mutant worm can't move at all, 35 show a very reduced ability to move, and the remaining 5 seem to have a completely wild-type phenotype with respect to movement ability. These observations suggest that e has O incomplete penetrance and variable expressivity O low expressivity and variable penetrance Ohigh expressivity and variable penetrance O high penetrance and incomplete expressivityarrow_forwardsuppose that for sexually active male drosophila fruit flies in a particular genetic lab, the mean lifespan is 38.9 days, with a standard deviation of 12.0 days. When she experimentally removed all female from a simple random sample of 24 drosophila male flies in this lab, a researcher found that the 24 sexually inactive males had a mean lifespan of 62.5 days, with a standard deviation of 14.1 days. Answer the questions below about the experiment about testing whether sexually activity significantly affects the mean lifespan of Drosophila males. a. in this experiment what was the independent variable? b. in this experiment what was the dependent variable?arrow_forward
- Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c.The fourth sequence shown above has two mutational differences from the first sequence. Specifically, the third codon is TTG versus CTC in the first sequence. These two codons are two mutational steps away from each other. Supposing that the CTC sequence gave rise to the TTG sequence, do you think it is more likely that the one-difference intermediate was TTC or CTG? d. In general, synonymous polymorphisms tend to be more common than nonsynonymous…arrow_forwardA scientist investigating the genome of two related individuals observes a difference of a few nucleotides in one individual compared to the other. The nucleotide differences are in a region of noncoding DNA on chromosome 1. Would these differences be considered a mutation? Why or why not? Yes, the difference in nucleotide sequences between the individuals is a mutation because it will affect the phenotype of the two individuals. Yes, any heritable variation in the nucleotide sequence is considered a mutation, even if that variation is in a noncoding region of DNA. Not enough information was provided to determine if this nucleotide difference is a mutation because the effect on phenotype is unknown. No, the change in nucleotide sequence doesn't appear in a coding region of the DNA and so can't be a mutation.arrow_forwardIn c. elegans, genetics model organism, movement problems (unc) and small body size (sma) are encoded by two mutant alleles that are recessive to those that produce wild-type traits (unc+ and sma+). A worm homozygous for movement problems and small body is crossed with a worm homozygous for the wild-type traits. The F1 have normal movement and normal body size. The F1 are then crossed with worms that have movement problems and small body size in a testcross. The progeny of this testcross is: Normal movement, normal body size 210 Movement problems, normal body size 9 Normal movement, small body size 11 Movement problems, small body size 193 a)From the test cross results, can you tell if the two genes are on the same chromosome or not? Explain your reasoning. b)What phenotypic proportions would be expected if the genes for round eyes and white body were located on different chromosomes? (please explain hot to get to these conclusions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
The Evolution of Populations: Natural Selection, Genetic Drift, and Gene Flow; Author: Professor Dave Explains;https://www.youtube.com/watch?v=SRWXEMlI0_U;License: Standard YouTube License, CC-BY
The Evolution of Humans | Evolution | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=Vf_dDp7drFg;License: Standard YouTube License, CC-BY