![Fundamentals of General, Organic, and Biological Chemistry, Books a la Carte Plus Mastering Chemistry with Pearson eText -- Access Card Package (8th Edition)](https://www.bartleby.com/isbn_cover_images/9780134261256/9780134261256_largeCoverImage.gif)
Fundamentals of General, Organic, and Biological Chemistry, Books a la Carte Plus Mastering Chemistry with Pearson eText -- Access Card Package (8th Edition)
8th Edition
ISBN: 9780134261256
Author: John McMurray, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27, Problem 27.16AP
Interpretation Introduction
Interpretation:
The portion of the human genome composed of repeat sequences has to be known.
Concept Introduction:
Human Genome:
In humans, the whole set of
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
On the basis of current knowledge, the protein-encoding regions account for only about 3% of the human genome. What is the function of the rest of the DNA?
What fraction of the human genome consists of transposons and retrotransposons?
The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?
Chapter 27 Solutions
Fundamentals of General, Organic, and Biological Chemistry, Books a la Carte Plus Mastering Chemistry with Pearson eText -- Access Card Package (8th Edition)
Ch. 27.1 - Decode the following sequence of letters to find...Ch. 27.3 - Prob. 27.1CIAPCh. 27.3 - Prob. 27.2CIAPCh. 27.3 - Prob. 27.3CIAPCh. 27.3 - Prob. 27.2KCPCh. 27.4 - Prob. 27.3PCh. 27.4 - A restriction enzyme known as EcoRI cuts DNA in...Ch. 27.4 - Prob. 27.5PCh. 27.5 - Classify the following activities according to the...Ch. 27.5 - Prob. 27.4CIAP
Ch. 27.5 - Prob. 27.5CIAPCh. 27.5 - Prob. 27.6CIAPCh. 27 - What steps are necessary in the mapping of the...Ch. 27 - Prob. 27.8UKCCh. 27 - List the four types of noncoding DNA (see Section...Ch. 27 - In general, what are the differences between...Ch. 27 - What is recombinant DNA? How can it be used to...Ch. 27 - Identify some major potential benefits of the...Ch. 27 - Prob. 27.13APCh. 27 - Prob. 27.14APCh. 27 - Prob. 27.15APCh. 27 - Prob. 27.16APCh. 27 - Prob. 27.17APCh. 27 - Prob. 27.18APCh. 27 - Prob. 27.19APCh. 27 - You may have heard of Dolly, the cloned sheep...Ch. 27 - Prob. 27.21APCh. 27 - Prob. 27.22APCh. 27 - What is the role of the enzyme telomerase? In what...Ch. 27 - Prob. 27.24APCh. 27 - Prob. 27.25APCh. 27 - Prob. 27.26APCh. 27 - Prob. 27.27APCh. 27 - What is a SNP?Ch. 27 - How are SNPs linked to traits in individual human...Ch. 27 - List some potential biological effects of SNPs.Ch. 27 - Prob. 27.31APCh. 27 - Prob. 27.32APCh. 27 - Prob. 27.33APCh. 27 - Prob. 27.34APCh. 27 - Prob. 27.35APCh. 27 - Prob. 27.36APCh. 27 - Prob. 27.37APCh. 27 - Prob. 27.38APCh. 27 - In the formation of recombinant DNA. a restriction...Ch. 27 - Give the sequence of unpaired bases that would be...Ch. 27 - Are the following base sequences sticky or not...Ch. 27 - Prob. 27.42APCh. 27 - Prob. 27.43APCh. 27 - Provide two examples of genetically engineered...Ch. 27 - Prob. 27.45APCh. 27 - Why is the field of bioethics so important in...Ch. 27 - Prob. 27.47CPCh. 27 - Prob. 27.48CPCh. 27 - Prob. 27.49CPCh. 27 - Prob. 27.50CPCh. 27 - What is a restriction endonuclease?Ch. 27 - Prob. 27.52CPCh. 27 - Prob. 27.53GPCh. 27 - One of the most actively pursued areas in genomics...Ch. 27 - Prob. 27.55GP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- With a few exceptions, interspersed repetitive DNA in the human genome has no known biological function. Explain in a few sentences what interspersed means. Name and describe one interspersed repetitive element. Provide information on about how much of the human genome consists of this one repetitive element (copy number and/or percent of genome).arrow_forwardWhat is meant by the statement “The genetic code is universal”? What is the significance of this finding?arrow_forwardApproximately how many Okazaki fragments are synthesized in thereplication of the human genome?arrow_forward
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardHuman Chromosome 22 (48 × 106 nucleotide pairs in length) has about 700 protein-coding genes, which average 19,000 nucleotide pairs in length and contain an average of 5.4 exons, each of which averages 266 nucleotide pairs. What fraction of the average protein-coding gene is converted into mRNA? What fraction of the chromosome do these genes occupy?arrow_forwardApproximately how many nucleotides and genes are contained in the human genome?arrow_forward
- What is Simple sequence repeat?arrow_forwardYour advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?arrow_forwardThe human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell if minuscule proportionsarrow_forward
- A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain genearrow_forwardA 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600 amino acids and the other gene encodes a protein of 280 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences (i.e. they do not overlap). How is this possible? Fully explain your answer.arrow_forwardWhy is the term “proteome” ambiguous, whereas the term“genome” is not?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License