BIOCHEMISTRY-ACHIEVE (1 TERM)
9th Edition
ISBN: 9781319402853
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 31, Problem 23P
Interpretation Introduction
Interpretation:
The peptide sequence of the given mRNA sequence should be determined.
Concept introduction:
tRNA (transfer ribonucleic acid) is a type of RNA, which decodes mRNA into a protein sequence. During the process of translation, tRNAs bind to specific sites on the ribosome. For each codon on mRNA, there is an anticodon on tRNA. Binding of these two RNAs helps in the proper synthesis of proteins.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
3
AAAGAGAAAAGAAUA
to AAAGAGAAAUGAAUA.
Suppose the codon sequence
has a single base pair mutation
If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene?
(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.)
Submit Answer
Retry Entire Group No more group attempts remain
Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript).
Strand 1
3’ End
TTG
CTT
CAC
CTT
GCG
CGC
CCG
CGC
TAA
TTG
5’ end
mRNA
Chapter 31 Solutions
BIOCHEMISTRY-ACHIEVE (1 TERM)
Ch. 31 - Prob. 1PCh. 31 - Prob. 2PCh. 31 - Prob. 3PCh. 31 - Prob. 4PCh. 31 - Prob. 5PCh. 31 - Prob. 6PCh. 31 - Prob. 7PCh. 31 - Prob. 8PCh. 31 - Prob. 9PCh. 31 - Prob. 10P
Ch. 31 - Prob. 11PCh. 31 - Prob. 12PCh. 31 - Prob. 13PCh. 31 - Prob. 14PCh. 31 - Prob. 15PCh. 31 - Prob. 16PCh. 31 - Prob. 17PCh. 31 - Prob. 18PCh. 31 - Prob. 19PCh. 31 - Prob. 20PCh. 31 - Prob. 21PCh. 31 - Prob. 22PCh. 31 - Prob. 23PCh. 31 - Prob. 24PCh. 31 - Prob. 25PCh. 31 - Prob. 26PCh. 31 - Prob. 27PCh. 31 - Prob. 28PCh. 31 - Prob. 29PCh. 31 - Prob. 30PCh. 31 - Prob. 31PCh. 31 - Prob. 32PCh. 31 - Prob. 33PCh. 31 - Prob. 34PCh. 31 - Prob. 35PCh. 31 - Prob. 36PCh. 31 - Prob. 37PCh. 31 - Prob. 38PCh. 31 - Prob. 39PCh. 31 - Prob. 40PCh. 31 - Prob. 41PCh. 31 - Prob. 42PCh. 31 - Prob. 43PCh. 31 - Prob. 44PCh. 31 - Prob. 45PCh. 31 - Prob. 46PCh. 31 - Prob. 47PCh. 31 - Prob. 48PCh. 31 - Prob. 49PCh. 31 - Prob. 50PCh. 31 - Prob. 51PCh. 31 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Question 8 Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain | Choose ) This site holds the tRNA that carries the next amino acid to be | Choose J added to the chain This site is the exit site, where discharged tRNAS leave the [ Choose ) ribosome Initiation, elongation and termination | Choose J >arrow_forward1arrow_forwardQuestion in Image. Thank you!arrow_forward
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardPlease answer. ASAP. Thank you!arrow_forwardwhich multiple choice?arrow_forward
- RNA sequence. Pls helparrow_forwardMultiple choice A. The role of tRNA in translation is to be translated by a ribosome. incorporate into a polypeptide chain. attach amino acids to a polypeptide chain. carry amino acids to the ribosome. Multiple choice B. Translation continues until the ribosome falls off the end of the RNA. the ribosome encounters a transcriptional termination site. the ribosome encounters a stop codon. the ribosome falls off the DNA.arrow_forwardOpen reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translationarrow_forward
- MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.arrow_forwardhelpp, if u could do this one first pleasearrow_forwardDescribe translation. What is the function of the aminoacyl-tRNA synthase?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license