BIOCHEMISTRY-ACHIEVE (1 TERM)
9th Edition
ISBN: 9781319402853
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 31, Problem 28P
Interpretation Introduction
Interpretation:
Aminoacyl-tRNA synthetases are the enzymes that decode the genetic code. The explanation of this statement should be determined.
Concept introduction:
Protein synthesis (translation) is a process of generating new protein sequences inside the cell. This process takes place in the cytoplasm of the cell. This process is balanced by the degradation or export of cellular proteins. It is constituted of three steps namely, initiation, elongation, and termination.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Translation. Write the anti-codon sequence of the MRNA transcript. Translate the
MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter
abbreviation.
ANTI-CODON
3'
5'
SEQUENCE
AMINO ACID
N-
C-
SEQUENCE (3 letter terminus
Abbreviation)
Terminus
AMINO ACID
N-
C-
SEQUENCE (1 letter terminus
Abbreviation)
Terminus
Hi, help please.
Which of the following is TRUE regarding RNA editing?
a .The coding sequence is altered in the chromosome
b. More than one answer choice is correct
c. The mRNA is altered by Guide RNAs
d. Translation first takes place, following by altering of the coding sequence
Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript).
Strand 1
3’ End
TTG
CTT
CAC
CTT
GCG
CGC
CCG
CGC
TAA
TTG
5’ end
mRNA
Chapter 31 Solutions
BIOCHEMISTRY-ACHIEVE (1 TERM)
Ch. 31 - Prob. 1PCh. 31 - Prob. 2PCh. 31 - Prob. 3PCh. 31 - Prob. 4PCh. 31 - Prob. 5PCh. 31 - Prob. 6PCh. 31 - Prob. 7PCh. 31 - Prob. 8PCh. 31 - Prob. 9PCh. 31 - Prob. 10P
Ch. 31 - Prob. 11PCh. 31 - Prob. 12PCh. 31 - Prob. 13PCh. 31 - Prob. 14PCh. 31 - Prob. 15PCh. 31 - Prob. 16PCh. 31 - Prob. 17PCh. 31 - Prob. 18PCh. 31 - Prob. 19PCh. 31 - Prob. 20PCh. 31 - Prob. 21PCh. 31 - Prob. 22PCh. 31 - Prob. 23PCh. 31 - Prob. 24PCh. 31 - Prob. 25PCh. 31 - Prob. 26PCh. 31 - Prob. 27PCh. 31 - Prob. 28PCh. 31 - Prob. 29PCh. 31 - Prob. 30PCh. 31 - Prob. 31PCh. 31 - Prob. 32PCh. 31 - Prob. 33PCh. 31 - Prob. 34PCh. 31 - Prob. 35PCh. 31 - Prob. 36PCh. 31 - Prob. 37PCh. 31 - Prob. 38PCh. 31 - Prob. 39PCh. 31 - Prob. 40PCh. 31 - Prob. 41PCh. 31 - Prob. 42PCh. 31 - Prob. 43PCh. 31 - Prob. 44PCh. 31 - Prob. 45PCh. 31 - Prob. 46PCh. 31 - Prob. 47PCh. 31 - Prob. 48PCh. 31 - Prob. 49PCh. 31 - Prob. 50PCh. 31 - Prob. 51PCh. 31 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainarrow_forwardI am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forwardTrue or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forward
- protein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the short guide RNA complementary to the first exon of Gene Y is expressed in all tissues. You subsequently sequence Gene Y in both brain and liver tissue. What would expect in each tissue? You can assume that the CRISPRICas9 system will impact both copies of Gene Y in cells, and that the first exon of Gene Y is necessary for Gene Ys function. a. Liver: Functional Gene Y; Brain: Functional Gene Y b. Liver: Nonfunctional Gene Y; Brain: Funtional Gene Y c. Liver: Functional Gene Y; Brain: Nonfunctional Gene Y d. Liver: Nonfunctional Gene Y; Brain: Nonfunctional Gene Yarrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward. Why is a nonsense suppressor tRNATyr, even though ithas a mutant anticodon that cannot recognize a tyrosinecodon, charged with tyrosine by Tyr tRNA synthetase?arrow_forward
- tRNA enzyme. Any given aminoacyl-tRNA synthetase: a. Attaches the amino acid to the 5′-end '5end of the tRNA b. Always recognizes only one specific tRNA c. Recognizes all tRNA molecules d. Forms an ester linkage between the amino acid and the tRNAarrow_forward1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.arrow_forwardBe sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А Аarrow_forward
- Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translationarrow_forward. The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. .AUAUAUAUAUAUAU-. What polypeptide would you expect to be produced? Precisely what information would this give you about the code?arrow_forwardGenetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tailarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY