EBK LIFE: THE SCIENCE OF BIOLOGY
EBK LIFE: THE SCIENCE OF BIOLOGY
11th Edition
ISBN: 8220103935432
Author: Sadava
Publisher: MAC HIGHER
Question
Book Icon
Chapter 4, Problem 2Q
Summary Introduction

To analyze:

The ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA), observation of a pattern, and the relation of this pattern to the RNA structure.

Given:

The composition of RNA is different in different organisms. The composition of RNA bases in some organisms is tabulated in Table 1 below:

Table 1: The composition of RNA bases in some organisms


Organism and the tissue from which RNA is extracted
The composition of RNA base (%)
Adenine Guanine Cytosine Uracil
Rat liver 19.2 28.5 27.5 24.8
Carp muscle 16.4 34.4 31.1 18.1
Yeast 25.1 30.2 20.1 24.6
Rabbit liver 25.1 30.2 20.1 24.6
Cat brain 19.7 26.8 25.8 27.6

Introduction:

The pyrimidines are heterocyclic compounds, which mean that there are more than two types of atoms in its cyclic structure. The pyrimidines contain a single ring system. The purines are also heterocyclic compounds but they contain a double ring system in which an imidazole ring (a five membered ring having nitrogen and hydrogen atoms) is attached to the pyrimidine ring.

The RNA consists of two types of purines that are, adenine (A) and guanine (G), and two types of pyrimidines that are, uracil (U) and cytosine (C). The RNA contains ribose sugar (presence of –OH at second carbon) instead of deoxyribose sugar (presence of –H at second carbon), and uracil is present as a base instead of thymine. Thymine is also called as the 5-methyl-uracil.

Blurred answer
Students have asked these similar questions
Given the following sequence for an RNA molecule, find a second- ary structure that will be maximally stable. GUCCAGCCAUUGCGUUCGCAAUGGC
Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing?  Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′
Christian Anfinsen showed that the enzyme Ribonuclease (RNase) is completely inactivated at high concentrations of beta mercaptoethanol (BME). When BME is removed, it restores only approximately 1% of RNase activity. When a very low concentration of BME is added back to RNase, its activity is restored to nearly 100%. Why? a   Low concentrations of BME causes disulfide bonds to break, but they randomly reform. b   High concentrations of BME disrupt all disulfide bonds, which inactivates the enzyme. At low concentrations all of the disulfide bonds reform and BME acts as a cofactor for the enzyme. c   The enzyme is only active when an intermediate number of disulfide bonds exists. which is achieved only at low concentrations of BME. d   The low concentration of BME allows the majority of the proteins to adopt their most stable form, which is the active form.
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning