To analyze:
The total GC (guanine and cytosine) and AT (adenine and thymine) content of deoxyribose
Given:
The percent (%) of DNA bases from some organisms have been compiled in the form of Table 1 below:
Table 1: Percent of DNA bases in some organisms.
Organism and the tissue from which DNA is extracted |
Composition of DNA base (%) | |||
Adenine | Guanine | Cytosine | Thymine | |
Herring sperm | 27.8 | 22.2 | 22.6 | 27.5 |
Rat bone marrow | 28.6 | 21.4 | 21.5 | 28.4 |
Human sperm | 30.7 | 19.3 | 18.8 | 31.2 |
Escherichia coli | 26.0 | 24.9 | 25.2 | 23.9 |
Yeast | 31.3 | 18.7 | 17.1 | 32.9 |
Introduction:
In every organism, the genetic material is passed from one generation to another generation in the form of a code, which is present in DNA. The DNA is a double-helix structure, which contains purines and pyrimidines. The purines present in DNA are adenine and guanine and the pyrimidines are cytosine and 5-methyl uracil (thymine).
Want to see the full answer?
Check out a sample textbook solutionChapter 4 Solutions
EBK LIFE: THE SCIENCE OF BIOLOGY
- The DNA chromosome in E. coli contains approximately 4 million base pairs. The average gene contains about 1500 base pairs. Use this information to calculate the following (show all work ): a) The length in meters of this chromosome. b) The approximate number of genes in the chromosome (assuming no wasted DNA).arrow_forwardIf DNA concentration is 2 grams, what would be the molar concentration of human DNA in a human cell?arrow_forwardFour cosmid clones, which we will call cosmids A, B, C, and D, werehybridized to each other in pairwise combinations. The insert size ofeach cosmid was also analyzed. The following results were obtained:arrow_forward
- In sheep DNA, the mol % of adenine (A) was found to be 28.3. Based on Chargaff's rule, what would be the approximate mol % of G, C, and T? mol % of G = mol % of C = mol % of T =arrow_forwardCalculate the weight in grams of a double-helical DNA molecule stretching from the Earth to the Moon (320000 km). Assume that the DNA double helix weighs 1 x 10-18 g per 1000 nucleotide pairs and that each base pair extends 3.4 Å weight:arrow_forwardThe amount of G plus C in an organism’s DNA is 64% of the total base content of that DNA. What are the percentages of A, T, G, and C?arrow_forward
- What is the concentration of a DNA solution that absorbs 0.812 and 0.463 at 260 and 280 nm, respectively? Is the DNA solution considered to be good quality? Why or why not?arrow_forwardA plot showing the % of denaturation as a function of temperature for a melting point of a DNA sample under 0.12 M NaCl gives an equation of a line of Y= 0.0074 X - 0.044. (where Y is the % of denaturation and X is the temperature in °C) Question: Calculate the melting point of this DNA in °C.arrow_forwardA 10 μL-aliquot of a resuspended genomic DNA stock solution was obtained and further diluted by adding 990 μL TE buffer. The A260 of the resulting solution was 0.316. Determine its concentration in µg/µL.arrow_forward
- Assume that the molar percentage of thymine in a double stranded DNA is 20. What are the percentages of the four bases (G, C, T, A)? b. The base content of a sample of DNA is as follows: A=31% G=31% T=19% C=19%. What conclusion can be drawn from this information?arrow_forwardThe following list of proteins are found in a mixture and are to be separated by 2D gel electrophoresis: Molecular weight (Daltons) Protein Isoelectric point Myoglobin 17,000 7.0 Cytochrome C 12,000 10.6 IgG 150,000 6.4 Hemoglobin 64,500 7.1 Insulin 5,800 5.4 Human serum albumin 66,000 4.6 Histone H3 15,000 10.8 Рepsin 33,000 1.0 In 2D electrophoresis, the mixture is first subjected to isoelectric focusing, separating them via their isoelectric pH values (corresponding to the horizontal axis, then subjected to SDS-PAGE to separate via molecular weight (corresponding to the vertical axis), where large proteins stay at top and smaller proteins go towards the bottom. 2 4 pH 7 10 direction of electric current 150 MW (kDa) 100 В E A 50 2 4 pH 7 10 With this information, match the letters of the bands to the proper protein based on the data given. Band Letter Protein A D Earrow_forwardChoose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHarrow_forward