ANATOMY+PHYSIOLOGY >CUSTOM<
9th Edition
ISBN: 2818440061721
Author: SALADIN
Publisher: MCG/CREATE
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 4.3, Problem 1AYLO
Summary Introduction
To discuss:
Why every generation of cells must synthesize new DNA, although the number of chromosome remains the same from one generation to the next.
Introduction:
Cell cycle is an essential process by which cells increase in number while maintaining its genetic stability. In an organism, it is vital for growth and regeneration. However, it has to be tightly regulated to avoid dire consequences. Twenty-three pairs of chromosomes (total 46) are present in the human DNA. All two pairs of chromosomes carry the same genes except X and Y chromosomes. The X and Y chromosomes are called as the sex chromosomes; they determine the sex of human beings. The remaining 22 pairs of chromosomes are termed as autosomes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of these molecules links the most of the individual DNA nucleotides together on the newly
synthesized strands of DNA?
topoisomerase
DNA polymerase
ligase
RNA primase
helicase
It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:
GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).
Polymerase chain reaction mimics the cells ability to:
translate mRNA into protein
transcribe dna to mrna
replicates dna
repair dna
edit dna
Chapter 4 Solutions
ANATOMY+PHYSIOLOGY >CUSTOM<
Ch. 4.1 - What are the three components of a nucleotide?...Ch. 4.1 - What governs the pattern of base paring in DNA?Ch. 4.1 - what is the difference between DNA and chromatin?Ch. 4.1 - Summarize the structural and functional...Ch. 4.1 - The general name of the monomers that compose DNA...Ch. 4.1 - Prob. 2AYLOCh. 4.1 - Prob. 3AYLOCh. 4.1 - How DNA and protein are combined to form...Ch. 4.1 - Prob. 5AYLOCh. 4.1 - HOW RNA differs from DNA in structure and...
Ch. 4.2 - Prob. 5BYGOCh. 4.2 - Describe the roles of RNA polymerase ribosomes,...Ch. 4.2 - What is the difference between genetic...Ch. 4.2 - Summarize the processing of a protein from the...Ch. 4.2 - Prob. 9BYGOCh. 4.2 - Prob. 10BYGOCh. 4.2 - Prob. 1AYLOCh. 4.2 - Prob. 2AYLOCh. 4.2 - The organization of nucleotides into DNA triplets;...Ch. 4.2 - How the genetic code relates mRNA codons to...Ch. 4.2 - The process and outcome of genetic transcription,...Ch. 4.2 - Prob. 6AYLOCh. 4.2 - Prob. 7AYLOCh. 4.2 - Prob. 8AYLOCh. 4.2 - Prob. 9AYLOCh. 4.2 - Prob. 10AYLOCh. 4.3 - Describe the genetic roles of DNA helicase and DNA...Ch. 4.3 - Explain why DNA replication is called...Ch. 4.3 - Define mutation. Explain why some mutations are...Ch. 4.3 - Prob. 14BYGOCh. 4.3 - Prob. 15BYGOCh. 4.3 - Prob. 16BYGOCh. 4.3 - Prob. 1AYLOCh. 4.3 - Semiconservative replication, the enzymes that...Ch. 4.3 - What a mutation is and how a cell detects and...Ch. 4.3 - The four stages of the cell cycle, what occurs in...Ch. 4.3 - Prob. 5AYLOCh. 4.3 - Cytokinesis and how it overlaps but differs from...Ch. 4.3 - Prob. 7AYLOCh. 4.3 - Prob. 8AYLOCh. 4.4 - Why must the carrier of a genetic disease be...Ch. 4.4 - Prob. 18BYGOCh. 4.4 - Prob. 19BYGOCh. 4.4 - Prob. 1AYLOCh. 4.4 - Organization of the karyotype; the number of...Ch. 4.4 - Prob. 3AYLOCh. 4.4 - Prob. 4AYLOCh. 4.4 - Prob. 5AYLOCh. 4.4 - Why a recessive trait can skip a generation, with...Ch. 4.4 - The differences between the genotype, genome, and...Ch. 4.4 - Prob. 8AYLOCh. 4.4 - Prob. 9AYLOCh. 4.4 - Prob. 10AYLOCh. 4.4 - Prob. 11AYLOCh. 4.4 - Prob. 12AYLOCh. 4.4 - Why it cannot be said that dominant alleles are...Ch. 4.4 - Prob. 14AYLOCh. 4.4 - Prob. 15AYLOCh. 4 - Production of more than one phenotypic trait by a...Ch. 4 - When a ribosome reads a codon on mRNA, it must...Ch. 4 - Prob. 3TYRCh. 4 - Two genetically identical strands of a metaphase...Ch. 4 - Prob. 5TYRCh. 4 - Genetic transcription is performed by a....Ch. 4 - Prob. 7TYRCh. 4 - Prob. 8TYRCh. 4 - Semiconservative replication occurs during a....Ch. 4 - Mutagens sometimes cause no harm to cells for all...Ch. 4 - The cytoplasmic division at the end of mitosis is...Ch. 4 - Prob. 12TYRCh. 4 - Prob. 13TYRCh. 4 - Prob. 14TYRCh. 4 - Prob. 15TYRCh. 4 - Prob. 16TYRCh. 4 - Prob. 17TYRCh. 4 - The cytoplasmic granule of RNA and protein that...Ch. 4 - Prob. 19TYRCh. 4 - Prob. 20TYRCh. 4 - Prob. 1BYMVCh. 4 - Prob. 2BYMVCh. 4 - Prob. 3BYMVCh. 4 - Prob. 4BYMVCh. 4 - Prob. 5BYMVCh. 4 - Prob. 6BYMVCh. 4 - Prob. 7BYMVCh. 4 - Prob. 8BYMVCh. 4 - Prob. 9BYMVCh. 4 - Prob. 10BYMVCh. 4 - Prob. 1WWTSCh. 4 - Steroids, carbohydrates, and phospholipids are...Ch. 4 - Prob. 3WWTSCh. 4 - Prob. 4WWTSCh. 4 - Prob. 5WWTSCh. 4 - The law of complementary base pairing describes...Ch. 4 - Prob. 7WWTSCh. 4 - All mutations result m the production of defective...Ch. 4 - Prob. 9WWTSCh. 4 - Prob. 10WWTSCh. 4 - Why world the supercoiled, condensed form of...Ch. 4 - Prob. 2TYCCh. 4 - Given the information in this chapter, present an...Ch. 4 - Prob. 4TYCCh. 4 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following statements is not true about DNA replication? a. It occurs during the M phase of the cell cycle. b. It makes a sister chromatid. c. It denatures DNA strands. d. It occurs semiconservatively. e. It follows base-pairing rules.arrow_forwardWhat is the function of DNA polymerase? a. It degrades DNA in cells. b. It adds RNA nucleotides to a new strand. c. It coils DNA around histones to form chromosomes. d. It adds DNA nucleotides to a replicating strand. e. None of these.arrow_forwardHow does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.arrow_forward
- Arrange the steps of DNA replication in the order that they occur. First step Helicase unwinds the DNA double helix. Last step Answer Bank DNA polymerase synthesizes DNA. RNA primers are added. DNA ligase joins DNA fragments together. RNA primers are removed. Single-stranded DNA-binding proteins bind to each template strand.arrow_forwardhow to extract DNA from everythingarrow_forwardIn the diagram below, a dotted line represents newly-synthesized DNA. What process is being shown? semi-conservative DNA replication DNA transcription RNA transcription translation conservative DNA replicationarrow_forward
- Which of the following statements BEST describes the process of DNA Replication? Group of answer choices The two strands of the parental molecule separate and serves as template for synthesis of a new strand. Each new strand is identical to its template strand. Each strand of both daughter molecules contains a mixture of old and newly synthesized DNA. The two parental strands reassociate after acting as templates for new strands restoring the parental double helix.arrow_forwardDraw replication forks that show what you would expect to see if a cell were unable to make the following enzymes: DNA Polymerase Helicase Primase Ligasearrow_forwardHow does DNA replication relate to the transmission of genetic material to future cells? Here are the choice DNA replication makes unique versions of the cell's genetic material so that it can be divided among future cells. DNA replication allows cells to make changes to improve their ability to function in different environments. DNA replication produces extra copies of a cell's genetic material so that there is less chance of a future cell receiving damaged DNA. DNA replication ensures that each cell produced by cell division has the same genetic information.arrow_forward
- Which of the following regarding DNA replication is FALSE. Replication of DNA is highly regulated. DNA is the only biomolecule that can be replicated. Replication is an amazingly complex process: it is amazing that can occur in a physiologically relevant time frame. The fact that DNA can be replicated allows it to serve as the genetic material. The progeny receive one strand that originated from the parent and one newly synthesized strand.arrow_forwardWhich statement about DNA clamps is TRUE? They prime synthesis of DNA. They form ends of eukaryotic chromosomes. They remove mismatched nucleotides. They consist of B2 subunits. They utilize ATP.arrow_forwardDNA transcription refers to? RNA synthesis DNA repair DNA duplication Protein synthesis DNA denaturationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license