Concept explainers
To discuss:
Why every generation of cells must synthesize new DNA, although the number of chromosome remains the same from one generation to the next.
Introduction:
Cell cycle is an essential process by which cells increase in number while maintaining its genetic stability. In an organism, it is vital for growth and regeneration. However, it has to be tightly regulated to avoid dire consequences. Twenty-three pairs of chromosomes (total 46) are present in the human DNA. All two pairs of chromosomes carry the same genes except X and Y chromosomes. The X and Y chromosomes are called as the sex chromosomes; they determine the sex of human beings. The remaining 22 pairs of chromosomes are termed as autosomes.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 4 Solutions
ANAT.+PHYS.LAB MANUAL-W/ACCESS >CUSTOM<
- Which of the following statements is not true about DNA replication? a. It occurs during the M phase of the cell cycle. b. It makes a sister chromatid. c. It denatures DNA strands. d. It occurs semiconservatively. e. It follows base-pairing rules.arrow_forwardWhat is the function of DNA polymerase? a. It degrades DNA in cells. b. It adds RNA nucleotides to a new strand. c. It coils DNA around histones to form chromosomes. d. It adds DNA nucleotides to a replicating strand. e. None of these.arrow_forwardHow does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.arrow_forward
- Best DNA repair system to fix - Depurination - Replication Slippage - Deanimation of Cytosine - Double stranded dna break outside of S-phasearrow_forwardDNA can copy itself through a process known as _____.arrow_forwardIt is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).arrow_forward
- Polymerase chain reaction mimics the cells ability to: translate mRNA into protein transcribe dna to mrna replicates dna repair dna edit dnaarrow_forwardWhich of these molecules links the most of the individual DNA nucleotides together on the newly synthesized strands of DNA? topoisomerase DNA polymerase ligase RNA primase helicasearrow_forwardArrange the steps of DNA replication in the order that they occur. First step Helicase unwinds the DNA double helix. Last step Answer Bank DNA polymerase synthesizes DNA. RNA primers are added. DNA ligase joins DNA fragments together. RNA primers are removed. Single-stranded DNA-binding proteins bind to each template strand.arrow_forward
- how to extract DNA from everythingarrow_forwardIn the diagram below, a dotted line represents newly-synthesized DNA. What process is being shown? semi-conservative DNA replication DNA transcription RNA transcription translation conservative DNA replicationarrow_forwardDNA replication is a process that involves copying the DNA molecule. If a single base was miscopied, what would be a possible result of this for the cell in which it happened? Top of Form All the proteins the cell creates from the miscopied strand will do different jobs than the old ones. If the new sequence codes for the same amino acid as the original cell, it will function normally. Both new DNA strands will end up together in a new cell, and the inaccurate one will be discarded. Any miscopied DNA will be replaced with an accurate DNA copy once the cell divides.arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)