EBK BIOLOGY
4th Edition
ISBN: 8220102797376
Author: BROOKER
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 44.3, Problem 1EQ
What is the normal function of the PPAR-δ protein in mice?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been associated with many types ofcancers. For this reason, researchers would like to develop drugs toinhibit oncogenic rasH. Based on your understanding of the Rasprotein, what types of drugs might you develop? In other words,what would be the structure of the drugs, and how would theyinhibit Ras protein? How would you test the efficacy of the drugs?What might be some side effects?
The lac genotypes are as shown below:
P+OcZ-Y+A+// P¯O+Z+Y+A+
(i)
The lac operon consists of three structural genes, lacZ, lacY and lacA. Which
structural genes are involved in lactose metabolism? Explain.
(ii)
Draw and explain how lactose repress the gene expression in lac IS/I- heterozygote.
(iii)
What is the function of the promoter in the bacterial operon?
How does the HAEIII enzyme discriminate between the C-G polymorphism in the TAS2R38 gene?
Chapter 44 Solutions
EBK BIOLOGY
Ch. 44.1 - Prob. 1CCCh. 44.2 - Prob. 1CCCh. 44.2 - Prob. 2CCCh. 44.2 - Prob. 1BCCh. 44.3 - Prob. 1CCCh. 44.3 - Prob. 1BCCh. 44.3 - What is the normal function of the PPAR- protein...Ch. 44.3 - CoreSKILL What was the hypothesis proposed by...Ch. 44.3 - CoreSKILL Assume that the mean weight of both...Ch. 44 - Prob. 1TY
Ch. 44 - Prob. 2TYCh. 44 - Prob. 3TYCh. 44 - Prob. 4TYCh. 44 - The function of ATP during muscle contraction is...Ch. 44 - Prob. 6TYCh. 44 - Stimulation of a muscle fiber by a motor neuron...Ch. 44 - Muscle fibers that have a large number of...Ch. 44 - Which of the following statements about movement...Ch. 44 - Prob. 10TYCh. 44 - Compare the structural and functional features of...Ch. 44 - List and briefly describe the steps in the...Ch. 44 - Prob. 3CQCh. 44 - Describe as many types of animal locomotion as you...Ch. 44 - Discuss the three types of muscle tissues found in...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (6th Edition) - standalone book
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
The term ‘spore’.
Biology Science Notebook
11. In the early 1800s, French naturalist Jean Baptiste Lamarck suggested that the best explanation for the rel...
Campbell Biology: Concepts & Connections (9th Edition)
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the major function of a Src homology-2 (SH2) domain?arrow_forwardWhat is claudin16 genearrow_forwardThere was a study done (Isabel, et al.) on structural analysis of SARS-CoV-2 spike protein. The researchers hypothesized that a mutation in Asp 614 to Gly 614 will result in a loss of four inter-chain destabilizing (i.e., hydrophobic-hydrophilic) contacts. I attached an image that illustrates this (C). My question is: how does this classify as a repelling effect when Asp 614 should be hydrogen bonding with Thr 859? If Asp 614 is mutated to Gly 614, then wouldn't this hydrogen bonding no longer occur? Just not too sure what this hydrophobic-hydrophilic repelling effect is referring to exactly.arrow_forward
- What are the primary structures of TATA-binding protein (for ex. letter amino acids), What are the secondary structures of TATA-binding protein (for ex. helices, sheets, etc), What are the tertiary structures of TATA-binding protein? What are the quaternary structures of TATA-binding protein?arrow_forwardA particular type of anemia in humans, called b-thalassemia,results from a severe reduction or absence of the normal b-globinchain of hemoglobin. However, the g@globin chain, normally onlyexpressed during fetal development, can functionally substitutefor b-globin. A variety of studies have explored the use of thenucleoside 5-azacytidine for the expression of g-globin in adultpatients with b-thalassemia.(a) How might 5-azacytidine lead to expression of g-globin inadult patients?(b) Explain why this drug may also have some adverse side effects.arrow_forwardWhat is the Results of tra splicing in the absence of Sxl protein?arrow_forward
- If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardConsider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…arrow_forwardATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of the following scenarios would most quickly regulate ATM activity in the cell? a) Adding silencing methyl groups to cytosines in the Atm gene b) Modifying the histone code for the Atm gene c) Increasing expression of a miRNA specific for the Atm mRNA d) Activating an E3 ubiquitin ligase specific for the ATM proteinarrow_forward
- Would the following alterations to Src be oncogenic? Explain. (a) The deletion or inactivation of the SH3 domain. (b) The mutation of Tyr 416 to Phe.arrow_forwardWhat fragments can be obtained from the treatment of Pro-Lys-Gly-Gly-Arg-Trp-His-Cys with trypsin and chymotrypsin simultaneously?arrow_forwardHow do loss of function mutations associated with Artemis (protein) cause their resulting phenotypes? Explain how genetically modified HSCs can treat these phenotypes.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY