BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
9th Edition
ISBN: 9781319425746
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 14P
Interpretation Introduction
Interpretation:
The information that is revealed by the given result about the structure of the encoded protein is to be stated.
Concept introduction:
DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C).
The reaction that is used to make the duplicates of a particular DNA segment is known polymerase chain reaction (PCR).
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
A gel pattern displaying PCR products shows four strong bands. The four pieces of DNA have lengths that are approximately in the ratio of 1 : 2 : 3 : 4. The largest band is cut out of the gel, and PCR is repeated with the same primers. Again, a ladder of four bands is evident in the gel. What does this result reveal about the structure of the encoded protein?
The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method
works, in the gel diagram, draw in the bands that will appear when DNA polymerase is added to the
reaction along with the four different nucleotide mixtures indicated. Note that some of these mixtures are
not what would normally be used in a sequencing reaction. Dideoxynucleatides (ddNTPs) are added in
relatively small amounts. The asterisk represents a radioactive label.
*5'
- 3'-ОН
3' –
-- ACGACGCAGGACATTAGAC-5'
Nucleotide mixtures:
A. DATP, DTTP, dCTP, DGTP, ddTTP (given)
B. DATP, ATTP, dCTP, AGTP, ddATE
C. dTTP, dGTP. ACTP, ddCTP, ddATP
D. DATP, dCTP, dTTP, ddGTP
A
в с D
| || ||
molecules continues to double every temperature cycle
(referred to as a PCR cycle).
(a) Suppose a sample containg x molecules is collected
from a crime scene and is amplified by PCR. Express
the number of DNA molecules as a function of the
number n of PCR cycles.
(b) There is a detection threshold of T molecules below
which no DNA can be seen. Derive an equation for the
number of PCR cycles it will take for the DNA sample
Amplifying DNA Polymerase Chain Reaction (PCR) is
a biochemical technique that allows scientists to take tiny
samples of DNA and amplify them into large samples that
can then be examined to determine the DNA sequence.
(This is useful, for example, in forensic science.) The pro-
cess works by mixing the sample with appropriate enzymes
and then heating it until the DNA double helix separates
into two individual strands. The enzymes then copy each
strand, and once the sample is cooled the number of DNA
molecules will have doubled. By repeatedly performing
this heating…
Chapter 5 Solutions
BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGAarrow_forwardPCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCGȚAGCTATATGCTATCGTGACGTATCGGCGCATTAAȚCGGGATCGAT 3 50 3' TGGCÁTCGATATACOATAGCACTOCATAGCCGCGTAATTÀGCCCTAGCTÀ 5' 5' AGCTÇGCTAGCAGGAGAGAȚATCGÇTCATAGCTCCGATCGATGCCGCTAA 3 3' TCGAGCG ATCGTCCTCTCTÁTAGCGAGTATCGAGÓCTAGCTACGGCGATİ 5' 100 5' TATAGCTCTÇTGCGGATATÇGCATATACCẠ AGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACOCCTATAGCGTATATGGTTCCGGGATGČATACATCGAŤ 5' 5 TGCGTATATÇGGAGAGTCCTGGATATGGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCÁTATAGCCTCICAGGÁCCTATACCTCGAACTGACGTCTCTCGAGCT 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 3. ATACGCGAATCCGGCATATACGAACCCCTÍTCGAGATACATACGATACAC 5' 250 5' TGCATGTGCTATGCAACGTTCOGATTGCGȚAGCAGTAATAGCGCCGATTG 3 300 3'…arrow_forwardThat's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment), please discuss the results and label and name the image to illustrate the answer? - Marker band sizes in gel: From top (well side) to bottom the bands have the following size in base-pair/bp- 6751,3652,2827,1568,1118,825,630arrow_forward
- Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…arrow_forwardAssume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’arrow_forwardExamine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.arrow_forward
- You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI (E), HindlII (H), and Xbal (X). You digest the plasmid DNA with each of the following combinations of enzymes and observe the results on an agarose gel. You are provided a partial plasmid map as shown below to the right. E H E+H E+X H+X Kb +4.3 +2.8 +2.5 - +2.0 -- -1.8 -1.5 12 +1.0 +0.8 +0.5 - a. What is the size of this plasmid in base pairs? b. What is the distance in base pairs between E1 and H? c. What is the distance in base pairs between E1 and X? d. What is the distance in base pairs between E2 and H? e. What is the distance in base pairs between E2 and X?arrow_forwardWhether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?arrow_forwardFor the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’arrow_forward
- Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation la: Several factors (including agarose gel concentration, time and current) affect migration of DNA fragments through the agarose gel. Briefly explain how each of these factors affects DNA migration. Agarose gel concentration: Time: Voltage: 1b: Do DNA fragments move towards the positive or negative end of the gel box? Explain your answer. 1c: What is the purpose of the Tris-Acetate-EDTA (TAE) buffer that the agarose gel is prepared with and submerged in for running? What would happen if you used water to prepare and run the gel instead of TAE buffer? 1d: If the student is homozygous for the brown allele, how many bands will they see in the lanes for the blue and brown allele samples? (circle one) Brown sample: 0 Blue sample: 1 2 more than two. 1 2 more than two. le: If the student is homozygous for the blue allele, how many bands will they see in the lanes for the blue and brown allele…arrow_forwardPCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCOȚAGCTATATOCTATCOTGACOTATCOGCOCATTAAȚCGGGATCGAT 3 3' TGGCATCGATATACGATAGCACTGCATAGCCGCGTAATTAGCCCTAGCTẢ 5 50 5' AGCTCGCTAGCAGGAGAGATATCGCTCATAGCTCCGATCGATGCCGCTAA 3 100 3' TCGAGCGATCGTCCICTCTATAGCGAGTAICGAGGCTAGCTACGGCGATİ 5' 5' TATAGCTCTCTGCGGATATÇGCATẠTACCAAGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACGCCTATAGCGTATATGGÍTCCGGGATGČATACATCGAŤ 5 5' TGCGȚATATÇGGAGAGTCCTGGATAT GGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCATATAGCCTCICAGGACCTATACCTCGAACÍGACGICTCTCGAGCİ 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 250 3' ATACGCGAATCCGGCATATACGAACCCCTITCGAĞATACATACG ẢTACAČ 5' 5' TGCATOTGCTATOCAACGTTC GGATTGCGȚAGCAGTAATAGCGCCGATTO 3' 300 3'…arrow_forwardThe diagram (below) shows the completed gel of a Sanger sequencing reaction. The arrows at the bottom point to the well positions where the DNA fragments started, with each nucleotide represented by a single letter abbreviation. Answer the following: • On which end of the image was the positive electrode placed? Type "top", "bottom", "left", or "right". Note that the bottom in this image is the location of the wells. Which well included the smallest DNA fragment at the beginning of the experiment? Type the single letter label for that well (ie, A, T, C, or G). • What is the sequence of the DNA strand synthesized in this Sanger sequencing reaction? Type the sequence starting on the 5' end. 5'- AWA с T G A -3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY