BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
9th Edition
ISBN: 9781319425746
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 10P
Interpretation Introduction
Interpretation:
The distance between the given PAM sequences is to be stated.
Concept introduction:
The full form of PAM sequence is Protospacer Adjacent Motif sequence. It is a small DNA sequence that contains approximately six base pairs lengthwise. The CRISPR-Cas9 targets the DNA region of PAM sequence for cleavage.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Cynt
Classifying mutations
A certain section of the coding (sense) strand of some DNA looks like this:
$-ATGTATATCTCCAGTTAG-3"
It's known that a very small gene is contained in this section.
Classify each of the possible mutations of this DNA shown in the table below.
mutant DNA
5- ATGTATCATCTCCAGTTAG-3'
S-ATGTATATCTCCAGTTAG-3
5- ATGTATATATCCAGTTAG-3'
type of mutation
(check all that apply)
insertion
deletion
point
silent
noisy
insertion
O deletion
point
silent
noisy
insertion
O deletion
point
silent
Onoisy
X
G
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs and is extremely specifi c for its own promoter. Why do these properties make T7 RNAP useful in experiments with recombinant DNA?
Chapter 5 Solutions
BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesn’t the mismatch repair system of E. coli eliminate these mismatches?arrow_forwardHeteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.arrow_forwardHelicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.arrow_forward
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forwardIn a typical microbiology laboratory, reasons for no bands from a gel of a polymerase chain reaction may bedue to errors relating to omission of ingredients in the reaction mix and absence of the target sequence inthe template DNA. Based on (i) primer problem and (ii) purity/potential contamination of the target sequence, explain the reason for non-appereance on bands.arrow_forwardpcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:arrow_forward
- Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.arrow_forwardPlease answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyarrow_forwardgene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forward
- Imagine a warm pond on the primordial Earth.Chance processes have just assembled a single copy of anRNA molecule with a catalytic site that can carry out RNAreplication. This RNA molecule folds into a structure thatis capable of linking nucleotides according to instructionsin an RNA template. Given an adequate supply of nucleo-tides, will this single RNA molecule be able to use itself as atemplate to catalyze its own replication? Why or why not?arrow_forwardConsider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence- specific DNA binding proteins, it must function as a homodimer Ex. Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These hydrophobic interactions are required for dimerization. The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of: Osecondary structure O tertiary structure O quaternary structure O secondary AND quaternary structure Ⓒ tertiary AND quaternary structurearrow_forwardLet’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the difficulties ofsequencing long repeated sequences, what other problems mightyou encounter in assembling these fragments?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license