Biochemistry: Concepts and Connections (2nd Edition)
2nd Edition
ISBN: 9780134641621
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 5, Problem 23P
If you want to purify a DNA-binding protein from a crude mixture of proteins at pH 7, should you use a DEAE-cellulose or a CM-cellulose column (see Figure 5.A5)? Briefly explain your reasoning.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Compare the melting temperature of a 1-kb segment of DNA containing20% A residues to that of a 1-kb segment containing 30% A residues under the same conditions.
You wish to purify a 55 kDa protein, but it is currently present as a mixture with another protein of approximately the same size. Briefly explain a purification strategy that you could use that would enable you to separate the two proteins.
If your DNA extraction were a concentration of 45ng DNA/ug, how would you prepare 500 ul of a 1 ng/ul solution of DNA in water?
Chapter 5 Solutions
Biochemistry: Concepts and Connections (2nd Edition)
Ch. 5 - Prob. 1PCh. 5 - Draw the structure of the peptide DTLH, showing...Ch. 5 - Prob. 3PCh. 5 - Prob. 4PCh. 5 - Prob. 5PCh. 5 - Prob. 6PCh. 5 - Prob. 7PCh. 5 - Given the following peptide SEPIMAPVEYPK a....Ch. 5 - A mutant form of polypeptide hormone angiotensin...Ch. 5 - Prob. 10P
Ch. 5 - Prob. 11PCh. 5 - a. Write a possible sequence for an mRNA segment...Ch. 5 - 13. Assume the following portion of an mRNA Find a...Ch. 5 - Prob. 14PCh. 5 - Prob. 15PCh. 5 - Prob. 16PCh. 5 - Prob. 17PCh. 5 - Prob. 18PCh. 5 - You are a summer intern in a clinical hematology...Ch. 5 - Prob. 20PCh. 5 - Despite the fact that many peptides have critical...Ch. 5 - Based on the information in Figure 5.17, which...Ch. 5 - If you want to purify a DNA-binding protein from a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Write a balanced equation for the hydrolytic deamination of a DNA5-methylcytosine residue.arrow_forwardWrite a balanced equation for the hydrolytic deamination of a DNA- 5-methylcytosine residue.arrow_forwardIn DNA purification, which step facilitates the separation of DNA from RNA? Also, what is the specific component in the buffer that enables this?arrow_forward
- To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?arrow_forwardGiven the structures of the nitrogenous bases shown in the picture, draw the structure of a part of DNA with the sequence: 5'-GTTCA-3'.arrow_forwardEach group will be provided with 20 g double-stranded DNA oligomer in STE buffer (0.1M NaCl/ Tris/ 10 mM EDTA, pH 7.4). The sequence of one strand of the oligomer is: 5’-AATGGTACGTATACTTTAT-3’ - show a table of % denaturation of DNA at different temperatures, using the equation provided in “Calculation” - plot a graph of % denaturation of DNA vs different temperatures with clear label and title, and hence determine the experimental Tm of the DNA sample - calculate the theoretical Tm of the sample using Marmur and Doty equation, compare the experimental Tm with theoretical Tm of the DNA samplearrow_forward
- The oligonucleotide d-ATGCCTGACT was subjected to sequencing by Sanger’s dideoxy method, and the products were analyzed by electrophoresis on a polyacrylamide. Draw a diagram of the gel banding pattern obtained.arrow_forwardAmino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are needed to codefor a protein with a molar mass of 5x10^5g/mol?arrow_forwardSpectroscopy is a useful tool to determine the concentration of DNA in a solution by measuring the UV absorbance at a wavelength of 260nm. When analyzing the purity of a DNA sample, an additional measurement of UV absorbance at 280nm is often taken to determine if proteins are is present as well. The ratio of 260/280 is then taken, and the closer this value is to 2 the more pure your DNA sample.a) Given that the aromatic rings present in the nitrogenous bases of DNA cause DNA to absorb UV light at 260nm, predict what might be responsible for proteins absorbing UV light at 280nm.b) You purify two DNA samples and measure the absorbance at 260nm and 280nm. For the first sample (Sample A) the absorbance at 280nm is 0, and for the second sample (Sample B) the absorbance at 260nm is 0.5. You are skeptical that Sample A is really that pure, and upon further testing you identify contaminating protein sequences (shown below) in both samples! Sample A contaminating protein: MSTSILEGAASTLSample B…arrow_forward
- Total nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with specialized beads to which the single-stranded DNA molecule with sequence 5’-TTTTTTTTTTTTTTTTTTTTTTTTT-3’ has been covalently attached to the surface (see image to the right, where each black line represents a polynucleotide sequence). After a short incubation time, the beads are removed from the mixture. When you analyze the cellular nucleic acids stuck to the beads, which type of nucleic acid (i.e. DNA, rRNA, etc.) do you expect to be the most abundant? Why?arrow_forwardA duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?arrow_forwardWhat is a protease enzyme? Why would we treat the strawberry extract with a protease in an extraction where the DNA needed to be subsequently analyzed?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license