The ovalbumin cDNA or ovalbumin genomic DNA should whether be used to form the protein in E.coli or not is to be stated. The reason corresponding to the correct choice is to be stated. Concept introduction: A segment which is located on hnRNA and cannot transfer genetic information is known as intron. A segement which is located on hnRNA and can encode single part of the mature RNA after eliminating the introns is known as exon. The protein that is mainly found in egg white and shows the 3 − D homology with the serpin is known as ovalbumin protein.

Question

Want to see the full answer?

Answer 1

Question

Chapter 5, Problem 2P

Interpretation Introduction

Interpretation:

The ovalbumin cDNA or ovalbumin genomic DNA should whether be used to form the protein in E.coli or not is to be stated. The reason corresponding to the correct choice is to be stated.

Concept introduction:

A segment which is located on hnRNA and cannot transfer genetic information is known as intron. A segement which is located on hnRNA and can encode single part of the mature RNA after eliminating the introns is known as exon.

The protein that is mainly found in egg white and shows the 3−D homology with the serpin is known as ovalbumin protein.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

True or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…

RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.

please help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosen