Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 7P
Interpretation Introduction
Interpretation:
The reason for the given statement should be explained.
Concept introduction:
DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C). In the formation of recombinant DNA, the restriction enzymes are involved to cut the particular region in the DNA molecule. This region is known as restriction site.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Restriction sites of Lambda (A) DNA - In base pairs (bp)
The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA
are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective
enzymes will cut.
A DNA
A
(bp)
48502
10 000
20 000
30 000
40 000
9162
17 198
B
Sal I
7059
14 885
28 338
35 603
42 900
(bp)
Hae III
11 826
21 935
29 341
38 016
(bp)
11648
29,624
Eco R1
(bp)
10 592 16 246
28 915
41 864
Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D)
DNA cut with Eco RI
1. Calculate the size of the resulting fragments as they will occur after digestion and write
the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see
figure 3A).
Page 3 of 7
9162
17 198
Sal i
(bp)
7059
14 885
28 338
35 603
42 900
Hae I
(bp)
11 826
21 935
29 341
38 016
11648
29,624
Eco R1
(bp)
10 592
16 246
28 915
41 864
please help me with this question.
As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.
Question. What would the forward primer sequence look like if it were intended to
bind the area of the DNA template?
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to- 3'5'-to-3' direction. Other helicases have been reported to move in the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why you would expect helicases to move in one direction or the other?arrow_forwardHomologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesn’t the mismatch repair system of E. coli eliminate these mismatches?arrow_forwardFunctional Consequences of Y-Family DNA Polymerase Structure The eukaryotic translesion DNA polymerases fall into the Y family of DNA polymerases. Structural studies reveal that their fingers and thumb domains are small and stubby (see Figure 28.10). In addition, Y-family polymerase active sites are more open and less constrained where base pairing leads to selection of a dNTP substrate for the polymerase reaction. Discuss the relevance of these structural differences. Would you expect Y-family polymerases to have 3-exonuclease activity? Explain your answer.arrow_forward
- Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.arrow_forward. Pancreatic deoxyribonuclease I (DNase I) is a nuclease that makes single-strand nicks on double-stranded DNA. It has been observed that treatment of nucleosomal core particles with DNase I yields a peculiar result. When DNA from such a digestion is electrophoresed under denaturing conditions, the single-stranded fragments are observed to occur in a regular periodicity of about 10 bases. Suggest an explanation of this result in terms of the structure of the nucleo- some.arrow_forwardRestriction mapping sample question You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, Xbal, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Enzyme(s) used PstI ECORI HincII Band sizes observed (kb) 5.3, 2.7 5.4, 2.6 4.5, 3.5 6.7, 1.3 | 4.0 (high intensity band) 3.9, 3.7, 0.4 4.0, 3.5, 0.5 3.5, 2.6, 1.9 3.7, 3.6, 0.4, 0.3 3.7, 2.2, 1.7, 0.4 3.7, 3.0, 0.9, 0.4 3.9, 3.5, 0.4, 0.2 Smal Xbal ВатHI HinclI + Xbal HincII + ECORI XbaI + BamHI ECORI + BamHI Smal + BamHI HincII + BamHI Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be…arrow_forward
- gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forwardplease help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenarrow_forwardRNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forward
- Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedurearrow_forwardPrimer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…arrow_forwardMay you please help me with this? A sample of purified DNA was incubated with deoxyribonuclease (DNAse) at 37oC. An aliquot was removed from the reaction mixture every minute for 5 minutes and the A260 recorded. The following data were obtained. Time (min) A260 0 0.60 1 0.64 2 0.67 3 0.70 4 0.72 5 0.73 Describe the action of deoxyribonuclease on DNA and explain the increase in A260.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License