Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 5, Problem 8P
Interpretation Introduction
Interpretation:
A rapid technique for producing many different mutations in the given region is to be stated.
Concept introduction:
DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C).
The process of alteration of DNA sequence or base pair of DNA in a normal gene that forms a mutant gene is known as mutation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Using the plasmid map of pBCH2.0
calculate the length of the shortest DNA fragment if this plasmid was digested with the restriction enzymes PstI and EcoRV.
The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the restriction enzyme sites at the ends of the human DNA insert. Hint: think about the compatibility of the ends generated by partial digestion of human DNA and complete digestion of the vector – will the original sites in the vector be regenerated or not, or it is impossible to predict?
Please answer need help
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Give typing answer with explanation and conclusionarrow_forwardE17. Gene mutagenesis is also used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino acid sequence affect the function of a protein. Let's suppose that you are interested in the functional importance of a particular glutamic acid (an amino acid) within a protein you are studying. By site-directed mutagenesis, you make mutant proteins in which this glutamic acid codon has been changed to other codons. You then test the encoded mutant proteins for functionality. The results are as follows: Functionality (%) Normal protein 100 Mutant proteins containing Тугosine Phenylalanine 3 Aspartic acid 94 Glycine From these results, what would you conclude about the functional significance of this glutamic acid within the protein?arrow_forwarda. What sequence information about a gene is lackingin a cDNA library?b. Can clones in a cDNA library contain 5′ UTR sequences? 3′ UTR sequences?c. Would you be likely to find on average longerORFs in cloned sequences from a genomic libraryor from a cDNA library? Explainarrow_forward
- Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up in a bacterial system. Because you're going to use bacteria to generate protein from a eukaryote, the mammoth, you need to get rid of introns from your sequence. How do you do that? Bioinformatically, I look for splice-site sequences and branch-point adenines and predict intron-exon boundaries I use a comparative genomic approach and use sequence homology with the genome of a closely related species I use a comparative genomic approach and use sequence homology with the genome of a distantly related species Both A and B Both B and C Why did you bother to identify the introns? So that I could include them in the sequence to understand intron function. So that I could exclude them from the sequence because prokaryotes don't have spliceosomal machinery. So that I could see how introns affect protein folding.arrow_forwardTransforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.arrow_forward6a and 6barrow_forward
- . Early gene-cloning experiments involved insertion at one restriction site in the vector; for example, the insert would have an EcoRI site at each end, and the vector would be opened at an RI site prior to ligation. Under what circumstances would asymmetric cloning be desirable, with the inset having a different restriction site at each endarrow_forwardGive typed full explanationarrow_forwardNot sure if my answer is correct.arrow_forward
- Imagine a warm pond on the primordial Earth.Chance processes have just assembled a single copy of anRNA molecule with a catalytic site that can carry out RNAreplication. This RNA molecule folds into a structure thatis capable of linking nucleotides according to instructionsin an RNA template. Given an adequate supply of nucleo-tides, will this single RNA molecule be able to use itself as atemplate to catalyze its own replication? Why or why not?arrow_forwardPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAAarrow_forwardgene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License