BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
9th Edition
ISBN: 2818000069358
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6, Problem 4P
Interpretation Introduction
Interpretation:
The base that tends to be paired with G in sequences that do not contain Watson-Crick base pairs is to be stated. A structure for the new base pair is to be proposed.
Concept introduction:
The RNA consists of four base pairs. Four base pairs of RNA molecule are adenine, uracil, guanine and cytosine. The base adenine is complementary with uracil and guanine is complementary with cytosine.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
Read it carefully.. Draw only correct diagrams..
In the Watson-Crick DNA base pairing model, Adenine (A) binds to thymine (T), guanine (G) binds to cytosine (C).
1. Draw the structures of thymine and adenine stabilized by Watson-Crick base pair interaction.
2. Also draw the structure of the amide group of glutamine in an interaction of this T-A pair in a way that maximally satisfies the hydrogen bonding capacity of amide.
Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5
determine what amino acid will be formed from the given DNA strand below:
3’ T A C A T G C C G A A T G C C 5’
Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
1. Partner DNA strand
2. the mRNA strand
3. The tRNA
4. the formed amino acids
5. the discussion of the entire procedure
Chapter 6 Solutions
BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.arrow_forwardThe subunits of the translation initiation complex in PROKARYOTES.* 1 point O 30S and 50S O 40S and 60S O 20S and 60S O 10S and 70S Normal pH of the human blood? * 1 point O 7.30 to 7.40 O 7.35 to 7.45 O 7.40 to 7.50 O 7.45 to 7.55 A structural motif that contains 2 cysteine and 2 histidine amino acids. * I point Helix-turn-helix Motifarrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- True or False. In a comparison between the DNAs of related organisms such as humans and mice, conserved sequences represent functionally important exons and regulatory regions, and non-conserved sequences generally represent noncoding DNA. Explain your answer in 2-3 sentences.arrow_forwardClose contact. Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved residues come within van der Waals contact of C-2'C-2' of the bound nucleotide. What is the potential significance of this interaction?arrow_forwardDNA Structure A. Draw an A-T base pair with the appropriate number of hydrogen bonds. You don’t have to include all the details such as every side-group but do depict the 3’ OH groups. B. What is meant by anti-parallel when referring to a DNA molecule? C. What are the major and minor grooves in the DNA structure and what significance do they have?arrow_forward
- Recall the DNA’s three-dimensional model. The DNA is a right-handed helix wherein onecomplete 360 0 turn covers a distance of 34 angstroms (Å) or 3.4 nm and 10 base pairs. As a result, thebase pairs are separated by a distance of approximately 3.4 Å. The diameter of the Watson and CrickDNA molecule is 20 Å.Calculate the average number of nucleotide pairs (or base pairs) per micrometer of DNA doublehelix according to the dimension mentioned above. Round off your answer to the nearest wholenumber. Note also that 1 micrometer = 10,000 angstroms.arrow_forwardAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forwardTrue or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…arrow_forward
- Question. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?arrow_forwardWhat is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGATarrow_forward5’ - A T G G C C C A A C T G A C C - 3’ a. How many nucleotides are listed here b. How many codons are listed here c. What are the three structural components of one nucleotide D.Write the appropriate sequence for the complementary strand above or below the sequence shown. Be sure to include which end of the complementary strand is 5’ and which end is 3 E.If the above sequence is the coding strand, write the RNA strand that will be transcribedarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license