WHAT IS LIFE ACHIEVE ACCESS ONLY >I<
5th Edition
ISBN: 9781319487317
Author: PHELAN
Publisher: INTER MAC
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6, Problem 4SA
Summary Introduction
To review:
Why “junk” DNA is a poor description of the non-coding regions of DNA in humans.
Introduction:
Non-coding DNA does not participate in the synthesis of any proteins.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
This is part of the Escherichia coli DNA sequence that contains an inverted repeat.
(Note: top strand is the coding strand).
5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3'
3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5'
Draw the structure of hairpin loop that will be formed during the end of transcription.
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA:
3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'
Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________
Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47:
mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-
polypeptide chain: ________--________--________--________--________--________--________--________
in the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages of the other nucleotides?
Chapter 6 Solutions
WHAT IS LIFE ACHIEVE ACCESS ONLY >I<
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Z-DNA derives its name from the zig-zag conformation ofphosphate groups. What features of the DNA molecule allowthis distinctive structure to form?arrow_forwardA duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?arrow_forwardUnder physiological conditions, DNA ordinarily formsB-DNA. However, RNA hairpins and DNA-RNAhybrids adopt the structure of A-DNA. Considering thestructural differences between DNA and RNA, explain thisphenomenon.arrow_forward
- Z-DNA derives its name from the zig-zag conformation of phosphate groups. What features of the DNA molecule allow this structure to form?arrow_forwardSupercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forwardIn sea urchin DNA, which is double stranded, 17.5percent of the bases were shown to be cytosine (C). Whatpercentages of the other three bases are expected to bepresent in this DNA?arrow_forward
- What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and minor grooves of double-stranded DNA, and what part(s) is/are found in the DNA backbone? If a DNA-binding protein does not recognize a specific nucleotide sequence, do you expect that it binds tothe major groove, the minor groove, or the DNA backbone? Explain.arrow_forwardAgarose gels with different average pore sizes areneeded to separate DNA molecules of different sizeclasses. For example, optimal separation of 1100 bpand 1200 bp fragments would require a gel with alarger average pore size than optimal separation of8500 bp and 8600 bp fragments. How do you thinkthat scientists prepare gels of different average poresizes? (Hint: Agarose gels are made in a mannersimilar to gelatin desserts such as JELL-O.)arrow_forwardHere is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?arrow_forward
- What is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the the sugar) in the B-form of DNA? syn anti alpha heteroarrow_forwardGiven this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxxarrow_forwardIn the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License