WHAT IS LIFE ACHIEVE ACCESS ONLY >I<
5th Edition
ISBN: 9781319487317
Author: PHELAN
Publisher: INTER MAC
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6, Problem 6SA
Summary Introduction
To review:
Why mRNA moves to the cytoplasm after it is synthesized.
Introduction:
The ribosomes are the site of protein synthesis, and the mRNA must reach them.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Some genes have the genetic code responsible for coding more than one protein based on the process of mRNA splicing in the nucleus of the eukaryotic cell.
Select one:
True
False
Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR. Studies of this gene have found that the Gene includes 250,000bp in the DNA. Scientists found that the mRNA had 6,500 nucleotides, and the final protein had 1480 amino acids.
How much of the mRNA is untranslated?
How much of the RNA that is produced does not leave the nucleus?
One of the mutations that results in a disease phenotype can be easily identified because the mutation results in a much longer mRNA then normal. Where would you look for this mutation? What might this mutation have affected?
Imagine you are going to label a gene associated with apoptosis in
Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To
generate the YFP, you know the pre-MRNA looks as follows:
Unspliced YFP premature mRNA
Сap
5' UTR
Exon 1
Intron
Exon 2
Intron
Exon 3
3' UTR
Poly-A tail
If Exon 2 is also required for mRNA stability, what can be predicted
from the possible spliced alternative isoforms formed?
One of the isoforms will not have a poly-A tail
O The alternative splicing of YFP pre-MRNA prevents 5'-capping
The MRNA isoform without Exon 2 will be degraded faster than the other
isoform
Exon 2 will be added to isoform B later to correct the mistake in splicing
The protein translated from one of the mRNA isoforms will possess an
additional functional domain
Chapter 6 Solutions
WHAT IS LIFE ACHIEVE ACCESS ONLY >I<
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Define, explain, and differentiate between, the processes of transcription and translation. What enzymes or sub-cellular structures are responsible for carrying out these processes?arrow_forwardTAC/ACC/GAC/GAA/AAT/TGT/TAC/CGT/TCA/AAC asap pleasearrow_forwardWhat would happen to an mRNA produced from a gene that contained a mutation in the 3'UTR region that deleted a cis-element required for poly A tailing?Question 20 options: The mRNA would be exported to the cytoplasm but would not be translated very efficiently The mRNA would never be exported to the cytoplasm The mRNA would not be spliced or exported to the cytoplasm The mRNA would be translated into a mutant proteinarrow_forward
- If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read in the 5’ to 3’ direction from the mRNA sequence, which ones are STOP codons?arrow_forwardIndicate which of the following items are associated with transcription or translation. This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription Sigma binds to the promoter mRNA binds to the small ribosomal subunit Spliceosomes remove introns and splice together exons Nucleotides are added from the 5' to 3' end tRNA anticodon binds to the corresponding mRNA codon STOP codon results in terminationarrow_forwardThe set of mRNAs present within a cell changes over time.Explain.arrow_forward
- What happens to the pre-mRNA before it migrates to the cytoplasm? Explainarrow_forwardWhich statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protienarrow_forwardThe following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCCAGACTCGCAarrow_forward
- The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCACCAGACTCGCAarrow_forwardWhat could a eukaryotic cell do during the transcription or translation process to stop a certain protein from being made? What could a eukaryotic cell do during the transcription or translation process to increase the production of a protein?arrow_forwardHere is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from the bottom strand of the DNA:arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY