Biochemistry (Looseleaf)
Biochemistry (Looseleaf)
9th Edition
ISBN: 9781319114800
Author: BERG
Publisher: MAC HIGHER
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 6, Problem 7P
Interpretation Introduction

Interpretation:

The alignment score for the alignment of the given two short sequences according to the given condition is to be calculated.

Concept introduction:

The organic compounds that contain amine (-NH2) and carboxyl (-COOH) functional groups with a side chain (-R) are known as amino acids. Proteins are the biomolecules which are composed of the long chain of amino acid residues. In two sequences of amino acids, when all the gap insertions are fixed that is alignment is fixed then the alignment score is determined.

Blurred answer
Students have asked these similar questions
Original sequence:    Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):  5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’    Question:    4) In a mutant you discovered that the underlined nucleotide has  been deleted. What would the resulting peptide sequence be? What  type of mutation is this?  5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Determining the amino acid sequence in a protein usually in- volves treating the protein with various reagents that break up the protein into smaller fragments that can be individually sequenced. Treating a particular 11-amino acid polypeptide with one reagent produced the fragments: Ala-Leu-Phe-Gly-Asn-Lys Trp-Glu-Cys Gly-Arg Treating the same polypeptide with a different reagent pro- duced the fragments: Glu-Cys Gly-Asn-Lys-Trp Gly-Arg-Ala-Leu-Phe What is the amino acid sequence of the polypeptide?
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY