Microbiology with Diseases by Taxonomy Plus Mastering Microbiology with Pearson eText -- Access Card Package (5th Edition)
5th Edition
ISBN: 9780133948851
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 12CT
Summary Introduction
To determine:
The reason behind the fact that the two strands of DNA are not effectively linked by covalent bonds.
Concept introduction:
Deoxyribonucleic acid
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
One strand of a double-helical DNA has the sequence (5′)GCGCAATATTTCTCAAAATATTGCGC(3′). Write the base sequence of the complementary strand. What special type of sequence is contained in thisDNA segment? Does the double-stranded DNA have the potential to form any alternative structures?
Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?
Because it is entropically unfavorable
Because that would cause a steric clash between the sugars and nucleobases
Because that would cause a steric clash between the 2' OHs of the sugars and the phosphates
Because uracil can't form hydrogen bonds with any other nucleobases
Using the straight-chain sugar convention where the vertical lines represent sugars and the diagonals are phosphodiester bonds, choose the correct structure of the DNADNA strand that encoded this short stretch of RNA.
pppApCpUpGpGpCpApA−OH
Chapter 7 Solutions
Microbiology with Diseases by Taxonomy Plus Mastering Microbiology with Pearson eText -- Access Card Package (5th Edition)
Ch. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - Prob. 3MCCh. 7 - Prob. 4MCCh. 7 - Prob. 5MCCh. 7 - Prob. 6MCCh. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - Prob. 9MCCh. 7 - Prob. 10MC
Ch. 7 - Which of the following is not a mechanism of...Ch. 7 - Prob. 12MCCh. 7 - Prob. 13MCCh. 7 - Which of the following are called jumping genes?...Ch. 7 - Prob. 15MCCh. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Prob. 24MCCh. 7 - The trp operon is repressible. This means it is...Ch. 7 - The three steps in RNA transcription are...Ch. 7 - Prob. 2FIBCh. 7 - Prob. 3FIBCh. 7 - Prob. 4FIBCh. 7 - An operon consists of ____________,...Ch. 7 - Prob. 6FIBCh. 7 - A daughter DNA molecule is composed of one...Ch. 7 - Prob. 8FIBCh. 7 - Prob. 9FIBCh. 7 - ____________ is a recombination event that occurs...Ch. 7 - Prob. 11FIBCh. 7 - Prob. 12FIBCh. 7 - Prob. 1SACh. 7 - Prob. 2SACh. 7 - Prob. 3SACh. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Prob. 5SACh. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Prob. 8SACh. 7 - Describe how DNA is packaged in both prokaryotes...Ch. 7 - Prob. 10SACh. 7 - Prob. 11SACh. 7 - Prob. 12SACh. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - Prob. 3VICh. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Prob. 3CTCh. 7 - Prob. 4CTCh. 7 - Prob. 5CTCh. 7 - Suppose that the E. coli gene for the lac operon...Ch. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Prob. 9CTCh. 7 - How can knowledge of nucleotide analogs be useful...Ch. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Prob. 12CTCh. 7 - Prob. 13CTCh. 7 - Prob. 14CTCh. 7 - Prob. 15CTCh. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Prob. 17CTCh. 7 - Prob. 1CMCh. 7 - DNA replication requires a large amount of energy,...Ch. 7 - In bacteria, polypeptide translation can begin...Ch. 7 - Prob. 3TMWCh. 7 - Prob. 4TMWCh. 7 - Clinical Case Study Deadly Horizontal Gene...Ch. 7 - Emerging Disease Case Study Vibrio Vulnificus...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?arrow_forwardWhy do you think it is important that the sugar-phosphate backbone of DNA be held together by covalent bonds while the two strands of double stranded DNA are held together by hydrogen bonds?arrow_forwardWhich of the following is not included in the Watson-Crick model of DNA structure? The strands run parallel to each other. The resultant helix is right-handed. Strands are held together by hydrogen bonds between nitrogenous bases. The bases are held together in the central region of the molecule by hydrogen bonds. It is composed of two strands.arrow_forward
- Why do you think DNA is the genetic material used by eukaryotes instead of RNA?arrow_forwardWhich of the following statements are true about doublestranded DNA?a. A + C = T + Gb. A + G = C + Tc. A + T = G + Cd. A/G = C/Te. A/G = T/Cf. (C + A) / (G + T) = 1arrow_forwardEscherichia coli and other bacteria methylate adenines on the original strand to distinguish the original strand from the newly replicated strand of DNA. Why is this distinction important?arrow_forward
- All of the following statements are correct EXCEPT a. DNA forms described by Watson and Crick have right handed helix except of Z-DNA form b. In case of Z-DNA form, the deoxyribose phosphate backbone forms a "Zigzag structure" c. Inverted DNA sequence repeat that happens within each individual strand of the DNA, called cruciform d. Plasmid carries genes that convey antibiotic resistance to the host bacteriumarrow_forwardWhen Chargaff was performing his experiments, the tetranucleotide hypothesis, which stated that DNA was composed of GACT nucleotide repeats, was the most widely accepted view of DNA’s composition. How did Chargaff disprove this hypothesis?arrow_forwardIn the DNA structure, a purine molecule always binds with a pyrimidine molecule. How would you expect the structure to differ if Adenine forms base pairing with Guanine and Cytosine forms base pairing with Thymidine? Instead of A-T, G-C; can it be A-G, C-T? Justify your answer within five sentencesarrow_forward
- Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'arrow_forwardHeinz Shuster collected the following data on the base composition of ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded? Percentage A G C T U Ribgrass mosaic virus 29.3 25.8 18.0 0.0 27.0arrow_forwardWhy is DNA & not RNA is the genetic material in majority of organisms?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License