![GENETIC ANALYSIS: AN INTEG. APP. W/MAS](https://www.bartleby.com/isbn_cover_images/9781323142790/9781323142790_largeCoverImage.gif)
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
2nd Edition
ISBN: 9781323142790
Author: Sanders
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 19P
Two viral genomes are sequenced, and the following percentages of
Genome
Genome
Are the DNA molecules in each genome single- stranded or double-stranded?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Are they true or false?
a)If someone reads an absorbance of 0,25 at 260 nm, the concentration of the dsDNA is 25 ug/ml.
b)If someone reads an absorbance of 0,25 at 260 nm, the concentration of the dsDNA is 25 ug/ml
c)The copy number refers to the number of molecules of an individual plasmid that are normally found in a single bacterial cell.
d)The amount of mRNA level can be determined via competitor RT-PCR in which two different sized products can be obtained, one of which is a known standard.
The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33% U. Is this sufficient data to determine whether the genomic material is DNA/RNA and is double- or single-stranded? Why or why not? Explain, using a diagram
Assume you isolate a single stranded (+) RNA virus. When you examine the proteins in the virus, you find that it does NOT contain replicase enzymes within its capsid. Which of the following is true?
This virus must have a gene that encodes replicase.
This virus will not be able to enter a host cell.
Its genome cannot be translated (the process of translation) by the host cell ribosomes.
A DNA copy of the viral genome has to be made before viral genes are expressed.
This virus must lack surface antigens.
Chapter 7 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Three independently assorting VNTR markers are...Ch. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - Prob. 35P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Double-stranded RNA viruses, use the following polymerase for genome synthesis: A) viral RNA-dependent RNA polymerase. B) host cell DNA-dependent RNA polymerase. C) viral DNA-dependent DNA polymerase. D) host cell RNA-dependent RNA polymerase.arrow_forwardThe table below shows the properties of the genomes of three different viruses. The data were obtained as follows: Nuclease sensitivity was measured by the ability of deoxyribonuclease (DNase) or ribonuclease (RNase) to destroy the genome (a “+" means sensitivity). The ability of the genome to act as mRNA was tested by incubating it in a cell-free system. If amino acids were incorporated into protein, the data are shown as a Finally, the virus particles were tested for the presence of a virion polymerase. If an enzyme was present, the data show whether it could polymerize deoxynucleotide triphosphates (DNTPS) or nucleoside triphosphates (NTPS). "+. Genome Properties Nuclease Virion Can Genome Sensitivity? Polymerase? Be an mRNA? Virus DNase RNase With With DNTPS NTPS #1 - - #2 - - #3 For each virus, indicate the strategy of the genome, using the Baltimore classification. What is the nature of the product of the virion polymerase when present? + + + + + +arrow_forwardA viral protein has a 20 amino acid amino acid chain consisting of the following primary structure: A-G-L-F-A-F-P-P-W-G-G-V-C-M-G-L-G-A-M-C In what places could these amino acids be found? a) Inside the hydrophobic core of a protein b) In a membrane that encloses the virus c) On the outside of a protein d) In a virus nail on the surface of the virusarrow_forward
- Two theoretical genetic strains of a virus (a-b-c- and a+b+c+) were used to simultaneously infect a culture of host bacteria. Of 10,000 plaques scored, the following genotypes were observed. Determine the genetic map of these three genes on the viral chromosome. Decide whether interference was positive or negative. a+ b+ c+ 4100 a- b+ c- 160 a- b- c- 3990 a+ b- c+ 140 a+ b- c- 740 a- b- c+ 90 a- b+ c+ 670 a+ b+ c- 110arrow_forwardHow many protein subunits would be present in a complex icosahedral virus particle with a triangulation (T) number of 8?arrow_forwardWhat is the significance of the length of a typical viral genome?arrow_forward
- 40) The molecular forces that hold the proteins of a capsule together are covalent bonds. True or false 41)The first successful gene therapy using a viral vector was to correct an enzyme deficiency (adenosine deaminase) in a girl. The virus used was adenovirus. True or false 50) How many chromatids are there in a chromosome at the end of G1? a) 1 b) 8 c) 4 d) 2arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardChemical composition analysis of a viral genome showed 22.1% A, 27.9% C, 27.9% G, and 22.1% U. Based on this, the viral genome is most likely made of: a) single-stranded (ss) DNA b) double-stranded (ds) DNA c) SSRNA d) dsRNA e) plasmid DNAarrow_forward
- Which biological system contains a protein nucleocapsid surrounding 2 antiparallel polynucleotide strands (held together by hydrogen bonds), with deoxyribose sugars, but no ribose sugars? a single-stranded RNA viroid (like avocado sun blotch viroid) a double-stranded RNA virus (like the reovirus family) a single-stranded DNA virus (like fX174 virus of E. coli) a double-stranded DNA virus (like the smallpox virus) a single-stranded RNA virus (like tobacco mosaic virus)arrow_forwardIn E. coli, the genes for histidine (his), arginine (arg), tyrosine (tyr), and valine (val) synthesis are closely linked. A wild-type strain is used as a donor for transducing viruses. Various recipient strains were treated with these viruses. Wild-type recombinant colonies were then counted, with the results shown in the following table. Genotype of recipient Number of wild-type colonies Genotype of recipient Number of wild-type colonies his- arg+ val+ tyr+ 254 his+ arg- val- tyr+ 132 his+ arg+ val- tyr- 36 his+ arg- val+ tyr+ 240 his- arg- val+ tyr+ 28 his- arg+ val- tyr+ 102 his- arg+ val+ tyr- 100 his+ arg- val+ tyr- 2 What is the cotransduction coefficient of histidine and valine? For consistency, standardize on histidine. 0.38 (wrong) 0.537 0.402 None of thesearrow_forwardGiven that COVID19 has a single strand RNA for its genome, the number of rounds required to complete replicating 3 viable virus particles? a) 3 b) 4 c) 5 d) 6 e) 9arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY