![GENETIC ANALYSIS: AN INTEG. APP. W/MAS](https://www.bartleby.com/isbn_cover_images/9781323142790/9781323142790_largeCoverImage.gif)
Concept explainers
One strand of a fragment of duplex DNA has the sequence
a. What is the sequence of the other strand in the duplex?
b. What is the name of the bond that joins one
c. Is the bond in part (b) a covalent or a noncovalent bond?
d. Which chemical groups of nucleotides react to form the bond in part (b)?
e. What enzymes catalyze the reaction in part (d)?
f. Identify the bond that joins one strand of a DNA duplex to the other strand.
g. Is the bond in part (f) a covalent or a noncovalent bond?
h. What term is used to describe the pattern of base pairing between one DNA strand and its partner in a duplex?
i. What term is used to describe the polarity of two DNA strands in a duplex?
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 7 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
- DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?arrow_forwardDescribe the structure and complementary base pairing of DNA.arrow_forwardHow many kilobases of the DNA strand below will code for the protein product?arrow_forward
- What defines one end of a DNA molecule as the 5’ end? a. What defines the other end at the 3’ end? b. When two strands of DNA are paired together to form a functional molecule, what is interesting to note about their 5’ and 3’ ends?arrow_forwardThe helix of an A-DNA differs from the helix of a B-DNA in all of the following EXCEPT which phrase? a. polarity of the strands b. thickness of the helix c. tilt of the bases d. appearance of the major and minor groovearrow_forwardOne strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?arrow_forward
- Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragmentarrow_forwardGiven the following DNA strand: TACAGAGATAACCGAATT A. Write the corresponding strand that would form the other half of the DNA molecule. B. Transcribe the original DNA strand (TACAGAGATAACCGAATT) and write the sequence of bases found in the resulting messenger RNA molecule. C. Translate your messenger RNA molecule and write the sequence of amino acids in the resulting protein (the genetic code is provided below).arrow_forward– Draw a DNA strand with 10 adenine bases followed by 10 cytosine bases. If that same strand bonded to a strand of 15 thymine bases and 5 guanine bases, how would the double helix shape vary from a typical DNA double helix? Explain why. Must draw picture of both strands that helps to illustrate your written answer – no credit for one without the other.arrow_forward
- A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the complementary base sequence for the matching strand in the DNA section shown below.5’ – C T G T A T A C G T T A – 3’ Please answer both partsarrow_forwardEnzymes can break down the DNA catalyze the hydrolysis of the covalent bonds that join nucleotides together. What would happen to DNA molecules treated with these enzymes? a. The two strands of the double helix would separate b. The phosphodiester linkages of the polynucleotide backbone would be broken. c. The pyrimidines would be separated from the deoxyribose sugar. d. All bases would be separated from the deoxyribose sugars.arrow_forwardDraw the structure of each dinucleotide and identify the 5 'and 3 ' ends. a. the deoxyribonucleotide formed by joining two deoxyguanosine 5 '-phosphates together b. the ribonucleotide formed by joining the 5 '-phosphate of UMP with the 3 '-OH of AMParrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)