GENETIC ANALYSIS: AN INTEG. APP. W/MAS
2nd Edition
ISBN: 9781323142790
Author: Sanders
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 34P
A sufficient amount of a small DNA fragment is available for dideoxy sequencing. The fragment to be sequenced contains 20
Dideoxy sequencing is carried out, and the products of the four sequencing reactions are separated by gel electrophoresis. Draw the bands you expect will appear on the gel from each of the sequencing reactions.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method
works, in the gel diagram, draw in the bands that will appear when DNA polymerase is added to the
reaction along with the four different nucleotide mixtures indicated. Note that some of these mixtures are
not what would normally be used in a sequencing reaction. Dideoxynucleatides (ddNTPs) are added in
relatively small amounts. The asterisk represents a radioactive label.
*5'
- 3'-ОН
3' –
-- ACGACGCAGGACATTAGAC-5'
Nucleotide mixtures:
A. DATP, DTTP, dCTP, DGTP, ddTTP (given)
B. DATP, ATTP, dCTP, AGTP, ddATE
C. dTTP, dGTP. ACTP, ddCTP, ddATP
D. DATP, dCTP, dTTP, ddGTP
A
в с D
| || ||
Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of
different lengths obtained by adding:
O All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials;
together with one of the 4 deoxynucleotides (DATP, DGTP, DCTP and DTTP), one for each
lane, in each vial.
O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials;
one for each lane
O All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the
4 deoxynucleotides (DATP, DGTP, dCTP and dTTP), to all of the reaction vials
O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials;
one for each lane, together with all of the 4 deoxynucleotides (dATP, DGTP, dCTP and
ATTP) in each vial
Given the following double-stranded fragment of DNA:
5'- ACTTGGCAGGCCTTCGATCC-3'
3'- TGAАССGTCСGGAAGCTAGG-5'
A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold
symmetry (typical for restriction enzymes) found in this fragment and catalyzes
cleavage of this DNA on both strands between GG nucleotides within the recognition
sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes).
Draw the double-stranded sequence of each fragment after cleavage showing any
phosphates left on the ends.
Chapter 7 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Three independently assorting VNTR markers are...Ch. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - Prob. 35P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; together with one of the 4 deoxynucleotides (dATP, DGTP, DCTP and dTTP), one for each lane, in each vial. O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane O All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the 4 deoxynucleotides (DATP, DGTP, DCTP and dTTP), to all of the reaction vials O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane, together with all of the 4 deoxynucleotides (DATP, dGTP, DCTP and dTTP) in each vialarrow_forwardGiven the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…arrow_forwardA linear DNA molecule is subjected to complete restriction digestion by (1) EcoRI alone, (2) HindIII alone, and (3) both enzymes together. The DNA fragments are then separated using gel electrophoresis. Results are shown below: (i) (ii) (iii) EcoRI Hindill Both | | — | | 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb How long is the original DNA molecule? How many EcoRI recognition sites does it have? Does the longest EcoRI fragment contain a HindIII restriction site? Explain your answer.arrow_forward
- The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'arrow_forwardThe chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?arrow_forwardwhat type of gel(in terms of material) can be more suitable for the electrophoresis of 500-1000bp DNA fragment and why?arrow_forward
- In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleoside triphosphate—say, ddCTP—is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What resultwould be observed if the dCTP were omitted?arrow_forwardThe partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given abovearrow_forwardYou are sequencing the genome of newly discovered bacterium, and know nothing of its sequence except that it is one single circular chromosome about 6,000,000 bp long. Your raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3' 5'-GTTACGCTTAGATAACACAAG-3' Based on this data, give the sequence of one sequence read: Based on this data, give the sequence of one sequence contig: C. So far, the researchers have assembled all the data they have into three sequence contigs. Have they sequenced the whole genome? Briefly explain, in one or two sentences.arrow_forward
- A 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the image below. Based on the band pattern observed here, write out the sequence of both the complementary strand generated during the experiment, and the template strand that is being analyzed. Be sure to clearly indicate the 5' and 3' ends of each. ddATP ddGTP ddCTP || | | ddTTP | 3' 5' Tyne a short answer in the space provided belowarrow_forwardIn Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that could influence the efficiency of this technique. Each cycle of this reaction has its own specific temperature. For instance, the denaturation step possesses a temperature of 94 - 98 ℃ to ensure that the double stranded DNA is fully separated. (i) (ii) (iii) Why is the annealing temperature vital in this technique? Explain how will this temperature affects the efficiency of this reaction. Why is Hot Start PCR technique preferred by some researchers? If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3' Calculate the melting temperature of this primer and estimate the annealing temperature of this primer.arrow_forwardconsider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License