![GENETIC ANALYSIS: AN INTEG. APP. W/MAS](https://www.bartleby.com/isbn_cover_images/9781323142790/9781323142790_largeCoverImage.gif)
Concept explainers
A family consisting of a mother (
a. Following the illustration style of Figure
b. Identify all the possible genotypes of children of this couple by specifying PCR fragment lengths in each genotype.
c. What genetic term best describes the pattern of inheritance of this DNA marker? Explain your choice.
![Check Mark](/static/check-mark.png)
Trending nowThis is a popular solution!
![Blurred answer](/static/blurred-answer.jpg)
Chapter 7 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
- The axial ratio is a term used to describe a rod-shaped molecule using the ratio of its length to its diameter. Given that the standard conformation of DNA in a physiological solution has a diameter of 2.37 nm, what is the axial ratio of the longest chromosome of Drosophila melanogaster DNA, which is 21000 µm long? Please record your answer in scientific notation. axial ratio: x10arrow_forwardCalculate the number of Alu elements present in the haploid human genome based on the number of Alu elements present in the clones analysed by the entire class. You will need to know the total length of DNA analysed and the number of Alu elements present. For the entire class, 57 Alu elements are present in 174,204 bp.arrow_forwardA molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’arrow_forward
- As the leading scientist in a biomedical science laboratory, it is a requirement to give advice to your lab assistants when they are having problems with their experiments. What advice would you give to your assistants that are having the following problems: After performing a polymerase chain reaction (PCR) and agarose gel electrophoresis to confirm the presence of the C01 gene of 750bp. 2.1. They observe no band appearing on an agarose gel. What would be your conclusion? 2.2. They observe three bands of different sizes that resemble a smear on the gel. Advice 2.3. They observe a single band on the gel and conclude that the PCR product is an exact copy of the original template DNA. Would you support their condusion? Explain. 2.4. Explain how PCR can be used to detect infectious agents in diagnoses of diseases.arrow_forwardThe presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome (BAC) clones (A–E) is indicated in the following table. Using these markers, put the BAC clones in their correct order and indicate the locations of the numbered sequences within them. Sequences BAC clone 1 2 3 4 5 6 A + − − − + − B − − − + − + C − + + − − − D − − + − + − E + − − + − −arrow_forwardUsing a laser beam, you isolated several R bands from human chromosomes. Answer the following questions What kinds of genes are present in R bands? Which isochors do you expect to be present in the R band? What class of interspersed repeats will be present in R bands? What class of tandem repeats do you expect to find in RG bands? Would you expect to find telomere sequences in some R bands?arrow_forward
- You are using the restriction enzyme HAEIII to digest different samples of the taster gene isolated from cheek cells of different people and amplified by PCR. When viewing the bands on the electrophoresis gel, one would expect that a taster (homozygote) would have---------band(s), whereas a carrier (heterozygote) would show--------band(s), and a non-taster would show------band(s).arrow_forwardA molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’ (b) What is branch migration? (c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes? (d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.arrow_forwardFor each genotype in the table below, determine whether or not functional B-gal will be produced in the presence or absence of the inducer. Write a plus (+) if B-gal is produced or a minus (-) if it is not. ma Chromosome F' lac (plasmid) - Inducer + Inducer ---- --- --- I*O*Z I*O°Z+ I*O*Z* I* = wildtype repressor |- - no functional repressor produced O* - wildtype operator OC = operator mutation prevents repressor from binding %3Darrow_forward
- E. coli chromosomes in which every nitrogen atom is labeled (that is, every nitrogen atom is the heavy isotope 15N instead of the normal isotope 14N) are allowed to replicate in an environment in which all the nitrogen is 14N. Using a solid line to represent a heavy polynucleotide chain and a dashed line for a light chain, sketch each of the following descriptions:a. The heavy parental chromosome and the products of the first replication after transfer to a 14N medium, assuming that the chromosome is one DNA double helix and that replication is semiconservative.b. Repeat part a, but now assume that replication is conservative.c. If the daughter chromosomes from the first division in 14N are spun in a cesium chloride density gradient and a single band is obtained, which of the possibilities in parts a and b can be ruled out? Reconsider the Meselson and Stahl experiment: What does it prove?arrow_forwardTo detect the CAG repeat expansion with a particular gene where 30 repeats in Normal changes to 250 repeats in a certain disease, how can we diagnose the condition. How To identify Y chromosome microdeletion ( which involves the deletion of AZF locus) using conventional karyotyping? If not then why. How will you diagnose a chromosomal translocation event?arrow_forwardWhat is recombination? Mention its applications with reference to genetic engineering.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)