BIO 102 General Biology II Updated Edition (Tidewater Community College)
3rd Edition
ISBN: 9781259614064
Author: Tidewater Community College
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 25WIO
Describe the mutation shown in figure 7.27 and explain how the mutation affects the amino acid sequence encoded by the gene.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in the mrna codon is not as serious as a mutation in the dna that corresponds to the first nitrogen base in the mrna codon
Which type of mutation results in abnormal amino acid sequence?
Explain Mutations in a gene are colinear with the sequence of amino acids in the encoded polypeptide?
Chapter 7 Solutions
BIO 102 General Biology II Updated Edition (Tidewater Community College)
Ch. 7.1 - How did Griffiths research, coupled with the work...Ch. 7.1 - How did the Hershey-Chase blender experiments...Ch. 7.2 - What are the components of DNA and its...Ch. 7.2 - What evidence enabled Watson and Crick to decipher...Ch. 7.2 - Prob. 3MCCh. 7.3 - What is the relationship between a gene and a...Ch. 7.3 - Prob. 2MCCh. 7.3 - What are the three types of RNA, and how does each...Ch. 7.4 - What happens during each stage of transcription?Ch. 7.4 - Where in the cell does transcription occur?
Ch. 7.4 - What is the role of RNA polymerase in...Ch. 7.4 - What are the roles of the promoter and terminator...Ch. 7.4 - How is mRNA modified before it leaves the nucleus...Ch. 7.5 - How did researchers determine that the genetic...Ch. 7.5 - What happens in each stage of translation?Ch. 7.5 - Where in the cell does translation occur?Ch. 7.5 - How are polypeptides modified after translation?Ch. 7.6 - What are some reasons that cells regulate gene...Ch. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.6 - Prob. 4MCCh. 7.7 - What is a mutation?Ch. 7.7 - What are the types of mutations, and how does each...Ch. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.7 - How are mutations important?Ch. 7.8 - What question about the FOXP2 gene were the...Ch. 7.8 - What insights could scientists gain by...Ch. 7 - A nucleotide is composed of all of the following...Ch. 7 - Prob. 2MCQCh. 7 - Transcription copies a _______ to a complementary...Ch. 7 - Choose the DNA sequence from which this mRNA...Ch. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - Prob. 7MCQCh. 7 - How does the lac operon regulate lactose digestion...Ch. 7 - Prob. 9MCQCh. 7 - Prob. 10MCQCh. 7 - Explain how Griffiths experiment and Avery,...Ch. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Prob. 4WIOCh. 7 - Put the following in order from smallest to...Ch. 7 - Prob. 6WIOCh. 7 - Prob. 7WIOCh. 7 - Prob. 8WIOCh. 7 - List the three major types of RNA and their...Ch. 7 - Some people compare DNA to a blueprint stored in...Ch. 7 - Prob. 11WIOCh. 7 - Prob. 12WIOCh. 7 - Refer to the figure to answer these questions: a....Ch. 7 - Prob. 14WIOCh. 7 - Prob. 15WIOCh. 7 - If a protein is 1259 amino acids long, what is the...Ch. 7 - Prob. 17WIOCh. 7 - The roundworm C. elegans has 556 cells when it...Ch. 7 - Prob. 19WIOCh. 7 - Prob. 20WIOCh. 7 - Prob. 21WIOCh. 7 - A protein-encoding region of a gene has the...Ch. 7 - Explain how a mutation in a protein-encoding gene,...Ch. 7 - Prob. 24WIOCh. 7 - Describe the mutation shown in figure 7.27 and...Ch. 7 - Prob. 26WIOCh. 7 - Prob. 27WIOCh. 7 - Prob. 28WIOCh. 7 - Prob. 29WIOCh. 7 - Refer to figure 7.28 and the chapter con tent to...Ch. 7 - Prob. 2PITCh. 7 - Prob. 3PITCh. 7 - Prob. 4PIT
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology (6th Edition)
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
What were the major microbiological interests of Martinus Beijerinck and Sergei Winogradsky? It can be said tha...
Brock Biology of Microorganisms (14th Edition)
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth
Identify me theme or themes exemplified by (a) the sharp quills of a porcupine (b) the development of a multice...
Campbell Biology in Focus
Explain why hyperthermophiles do not cause disease in humans.
Microbiology with Diseases by Taxonomy (5th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.arrow_forwardName three different types of loss of function mutations and in each case explain how the mutation exerts a loss of function effect on a genearrow_forwardExplain why STR mutations are found at a much higher frequency than single nucleotide changes?arrow_forward
- Compare the severity of DNA mutations that produce the following changes in mRNA codons:(a) GCU to GCC (b) ACU to AUUarrow_forwardName and explain the three possible consequences of having a mutation somewhere in the region from 61-75.arrow_forwardClassify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a.) AGC (ser): ________b.) UGU (cys): ________c.) GGC (gly): _______d.) UGA (stop): _______e.) UUC (phen): _______arrow_forward
- For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above)arrow_forwardExplain why a point mutation does not necessarily change the oriignal amino acid sequence. Explain silent mutations.arrow_forwardA mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.arrow_forward
- explain gene mutationarrow_forwardWhat happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.arrow_forwardWhat type of mutation is shown in the diagram? Why do you think this type of mutation is referred to by this term?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY