Concept explainers
(i)
To create:
The frame shift mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT
Introduction:
The mutation which occurs in introns is insertion or deletion. It can cause shift in open reading frame of the gene sequence, and can change the amino acid sequence of the coded protein.
(i)
Explanation of Solution
Change in the genetic sequence of DNA, by addition and deletion of nucleotides, results in gene mutation.
Insertion mutation: This mutation occurs by insertion of one or more nucleotides in the DNA sequence. Insertion mutation is a type of frame shift mutation, as insertion of a single
Original DNA sequence:
Frame shift due to insertion mutation:
Deletion mutation: This mutation occurs due to removal of one or more nucleotides from DNA sequence. Deletion mutation is a type of frame shift mutation, as removal of a single nucleotide shifts the whole reading frame in the DNA.
Original DNA sequence:
Frame shift due to deletion mutation:
(ii)
To create:
The silent mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT
Introduction:
The mutations in the codons that do not change the particular amino acid in the given polypeptide chain are called synonymous mutations. They are also called silent mutations because they cause no change in the structure of the protein.
(ii)
Explanation of Solution
Silent mutation involves base substitution which results in same amino acids that was encoded by previous nucleotidal sequence.
Original DNA sequence:
Corresponding RNA sequence:
Amino acid sequence: Tyrosine Glutamine Methionine Histidine Serine Proline
Silent mutation:
Corresponding RNA sequence:
Amino acid sequence: Tyrosine Glutamine Methionine Histidine Serine Proline
(iii)
To create:
The nonsense mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT
Introduction:
The nonsense mutations are the mutations that generate the stop codon. The generated stop codon terminates the translational process and thus, the protein structure will not be formed because no more amino acids will be added to the sequence.
(iii)
Explanation of Solution
Nonsense mutation involves substitution of a single base pair that yields a stop codon.
Original DNA sequence:
Nonsense mutation:
Corresponding RNA sequence:
Want to see more full solutions like this?
Chapter 8 Solutions
MICROBIOLOGY FUNDAMENTALS (LOOSELEAF)
- If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?arrow_forwardDefine and compare the following types of nucleotide substitutions. Which is likely to cause the most dramatic mutant effect? a. missense mutation b. nonsense mutation c. sense mutationarrow_forwardAlthough it is well known that X-rays cause mutations, they are routinely used to diagnose medical problems, including potential tumors, broken bones, and dental cavities. Why is this done? What precautions need to be taken?arrow_forward
- What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was substituted with C (Question C) ? Question C: Guanine nucleotide (G shown in red in the DNA sequence below) was substituted by C Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)arrow_forwardWhat type DNA mutation is TACAT?arrow_forwardWhy are frameshift mutations likely to be more detrimental than point mutations, in which a single pyrimidine or purine has been substituted?arrow_forward
- Is each of the following mutations a transition, transversion, addition,or deletion? The original DNA strand is 5′–GGACTAGATAC–3′(Note: Only the coding DNA strand is shown.)A. 5′–GAACTAGATAC–3′B. 5′–GGACTAGAGAC–3′C. 5′–GGACTAGTAC–3′D. 5′–GGAGTAGATAC–3′arrow_forwardWhat is a transposon? Explain why the insertion of a transposon into the DNA of a cell can lead to a mutationarrow_forwardGiven the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’arrow_forward
- Patient 1: a conservative missense mutation affecting amino acid 75 Patient 2: a synonymous mutation affecting amino acid 250 Patient 3: a nonsense mutation at amino acid 100. Patient 4: a 2 base-pair insertion after amino acid 352arrow_forwardHow might a single base pair difference about 100 bases before the start codon of a gene cause a mutation in that gene?arrow_forwardWhich of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA Mutated – CCU-GAU-GAG-UGA* Please choose one correct answer only A. Missense B. Nonsense C. Silent D. Frameshiftarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning