MICROBIOLOGY-ACCESS >CUSTOM<
13th Edition
ISBN: 9780135668825
Author: Tortora
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 4R
The following is a code for a strand of DNA.
- a. Using the genetic code provided in Figure 8.8, fill in the blanks to complete the segment of DNA shown.
- b. Fill in the blanks to complete the sequence of amino acids coded for by this strand of DNA.
- c. Write the code for the complementary strand of DNA completed in part (a).
- d. What would be the effect if C were substituted for T at base 10?
- e. What would be the effect if A were substituted for G at base 11?
- f. What would be the effect if G were substituted for T at base 14?
- g. What would be the effect if C were inserted between bases 9 and 10?
- h. How would UV radiation affect this strand of DNA?
- i. Identify a nonsense sequence in this strand of DNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
For each example:
a. fill in the complimentary DNA strand
b. fill in the correct mRNA bases by transcribing the bottom DNA code
c. fill in the correct tRNA bases
d. translate the MRNA codons to find the correct amino acids
Example #1
5'
3'
(A (A
DNA
MRNA
TRNA
Amino
Acids
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC
Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC
Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence:
Name and explain two different ways in which DNA can be damaged.
Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
Give the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’
Chapter 8 Solutions
MICROBIOLOGY-ACCESS >CUSTOM<
Ch. 8 - Briefly describe the components of DNA, and...Ch. 8 - DRAW IT Identify and mark each of the following on...Ch. 8 - Match the following examples of mutagens. Column A...Ch. 8 - The following is a code for a strand of DNA. a....Ch. 8 - Prob. 5RCh. 8 - Identify when (before transcription, after...Ch. 8 - Which sequence is the best target for damage by UV...Ch. 8 - You are provided with cultures with the following...Ch. 8 - Why are mutation and recombination important in...Ch. 8 - NAME IT Normally a commensal in the human...
Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Feedback inhibition differs from repression...Ch. 8 - Bacteria can acquire antibiotic resistance by all...Ch. 8 - Suppose you inoculate three flasks of minimal...Ch. 8 - Plasmids differ from transposons in that plasmids...Ch. 8 - Mechanism by which the presence of glucose...Ch. 8 - The mechanism by which lactose controls the lac...Ch. 8 - Two offspring cells are most likely to inherit...Ch. 8 - Which of the following is not a method of...Ch. 8 - Nucleoside analogs and ionizing radiation are used...Ch. 8 - Replication of the E. coli chromosome takes 40 to...Ch. 8 - Pseudomonas has a plasmid containing the mer...Ch. 8 - Ciprofloxacin, erythromycin, and acyclovir are...Ch. 8 - HIV, the virus that causes AIDS, was isolated from...Ch. 8 - Human herpesvirus-8 (HHV-8) is common in parts of...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (2nd Edition)
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (12th Edition)
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues (8th Edition)
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (3rd Edition)
Propose a model for the assembly of a flagellum in a typical Gram-positive cell envelope.
Prescott's Microbiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Please consider the figure below. a. Give the name of the process illustrated in the figure. b. If this is part of the elongation stage, explain what is going to happen next. Use the labels, A, B, C and/or D to answer the question. C. What terminus of the protein is represented by the amino acid represented by label D?arrow_forwardTake each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forwardThe following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forward
- A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of the mutant DNA strand? The sequence of the mutant strand is shown below: 5'-TGCCATAACTGTTCGTACTGGCAAATTGCC-3' 3'-ACGGTATTGACAAGCATGACCGTTTAACGG-5' b. The mutation altered the sequence of the wild type template DNA such that a degenerate codon for a basic amino acid in the wild type was converted to a non-degenerate codon resulting in the sequence for the mutant strand shown. What was the original amino acid? c. Compare the charges and pl of the mutant peptide and the normal (wild- type) peptide at physiological pH?arrow_forwardWhich of the following statements is TRUE concerning the synthesis of the leading and lagging strands of DNA in prokaryotic cells? a. O b. The leading strand is synthesized by one polymerase III continuously, and the lagging strand is synthesized by several molecules of DNA polymerase III. d. The leading and lagging strands are synthesized at the same time by the one DNA polymerase I. O c. The leading and lagging strands are synthesized at the same time by the one DNA polymerase III. The leading strand is synthesized by one polymerase III, and the lagging strand is synthesized by DNA polymerase I.arrow_forwardIn one, simple sentence define the function of the following 1. Helicase = 2. Alpha subunit of DNA polymerase III =arrow_forward
- Indicate whether each of the following statements is true or false. If a statement is false, explain why it is false. A. The repair polymerase is the enzyme that proofreads the newly synthesized strands to ensure the accuracy of DNA replication. B. There is a single enzyme that degrades the RNA primers and lays down the corresponding DNA sequence behind it. C. DNA ligase is required to seal the sugar-phosphate backbone between all the DNA fragments on the lagging strand. D. The repair polymerase does not require the aid of the sliding clamp, because it is only synthesizing DNA over very short stretches. Answer the following questions about DNA replication. On a DNA strand that is being synthesized, which end is growing the 3' end, the 5' end, or both ends? Explain your answer. А. B. On a DNA strand that is being used as a template, where is the copying occurring relative to the replication origin-3' of the origin, 5', or both?arrow_forwardSome antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.arrow_forwardPlease consider the figure below. a. Give the name of the process illustrated in the figure. b. If this is part of the elongation stage, explain what is going to happen next. Use the labels, A, B and/or C to answer the question. c. What type of enzyme is involved in the process described in (b)? d. What terminus of the protein is represented by label A?arrow_forward
- a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?arrow_forwardIndicate whether each of the following statements about the double-helix secondary structure of DNA is true or false. a. The two polynucleotide strands are complementary rather than identical. b. Bases present extend outward from the double helix. c. Covalent bonding occurs between the two polynucleotide strands. d. The two polynucleotide strands run in the 5′-to-3′ directionarrow_forwardWhich statement below is true? Select one: a. Okazaki fragments are produced in eukaryotic DNA replication but not in prokaryotic DNA replication. b. In both eukaryotes and prokaryotes, the template strand of DNA is read in the template’s 3’ to 5’ direction, while the new strand DNA is synthesized in new strand’s 5’ to 3’ direction. c. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is random. d. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is from 3’ to 5’. e. In eukaryotes, synthesis of the new DNA strand is from 3’ to 5’, whereas in prokaryotes it is from 5’ to 3’.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY