![HUMAN HEREDITY (LL)-W/MINDTAP ACCESS](https://www.bartleby.com/isbn_cover_images/9781305717022/9781305717022_largeCoverImage.gif)
HUMAN HEREDITY (LL)-W/MINDTAP ACCESS
11th Edition
ISBN: 9781305717022
Author: Cummings
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 10QP
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site.
- a. normal-length transcript, normal-length nonfunctional protein
- b. normal-length transcript, no protein made
- c. normal-length transcript, normal-length mRNA, short nonfunctional protein
- d. normal-length transcript, longer mRNA, shorter nonfunctional protein
- e. transcript never made
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Trending nowThis is a popular solution!
![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations.
3. The swo-1 a mutation (insertion between C and G).
4. The swo-1 b mutation (C-to-T mutation for indicated C).
5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.
The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold).
a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the final page)
Chapter 9 Solutions
HUMAN HEREDITY (LL)-W/MINDTAP ACCESS
Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - The Link Between Genes and proteins The genetic...Ch. 9 - Define replication, transcription, and...Ch. 9 - If the genetic code used 4 bases at a time, how...Ch. 9 - If the genetic code uses triplets, how many...Ch. 9 - What is the start codon? What are the stop codons?...
Ch. 9 - Is an entire chromosome made into an mRNA during...Ch. 9 - The promoter and terminator regions of genes are...Ch. 9 - The following segment of DNA codes for a protein....Ch. 9 - What are the three modifications made to pre-mRNA...Ch. 9 - The pre-mRNA transcript and protein made by...Ch. 9 - Briefly describe the function of the following in...Ch. 9 - Prob. 12QPCh. 9 - Determine the percent of the following gene that...Ch. 9 - How many kilobases of the DNA strand below will...Ch. 9 - Prob. 15QPCh. 9 - Given the following tRNA anticodon sequence,...Ch. 9 - Given the following mRNA, write the...Ch. 9 - The following is a portion of a protein:...Ch. 9 - Below is the structure of glycine. Draw a...Ch. 9 - Indicate in which category, transcription or...Ch. 9 - Prob. 21QPCh. 9 - Polypeptide folding is often mediated by other...Ch. 9 - Do mutations in DNA alter proteins all the time?Ch. 9 - a. Can a mutation change a proteins tertiary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Arrange the statements in their proper order by writing the corresponding letter (e.g. A) for each statement in the space provided below. A. The single-stranded RNA would complement the target RNA. B. Gene expression is inactivated once the mRNA is no longer accessible for translation. C. The risk-induced silencing complex which is composed of RNA and protein subunits is formed. D. Double-stranded, non-coding RNA is cleaved by Dicer. E. The mRNA can be cleaved or remain bound by the RISC. 1. 2. 3. 4. 5.arrow_forwardIdentify the best match between the mutation description and term. a. Transversion: results in a change in single nucleotide from a purine to another purine or a pyrimidine to another pyrimidine b. Nonsense mutation: a change in the DNA that changes the codon code from one amino acid to another amino acid c. Missense mutation: causes a drastic change in phenotype because the change causes a premature stop in the amino acid sequence d. Indel: has the potential to cause large changes in transcription and subsequence amino acid sequence due to reading frameshiftsarrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forward
- The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.arrow_forwardHaemochromatosis is a recessive disorder caused by mutations in the HFE gene. The disorder can be the result of nonfunctional HFE protein, or from very low levels (expression) of the HFE protein. Below is a northern blot gel showing the amount and size of HFE mRNA for a person who does not have haemochromatosis (WT). The mRNA was loaded at the top of the gel. WT A B C D Position the bands on the gel shown in each question as directed. Part 1 Tom has a mutation which changes the sequence of an enhancer region adjacent to the TATAA box for this gene. Position Tom's band in Lane A. WT A B 00arrow_forward) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).arrow_forward
- Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.arrow_forwardA peptide is produced in two different cells. The primary structure is the same in both cells, but the amount of peptide is increased in one cell. What could be happening to the pre-mRNA or mRNA transcript within the cell that has the higher amount of this peptide? A. It has a shorter Poly-A tail B. An alternative polyadenylation (Poly-A) site is being selected C. Leaky scanning occurred D. B and C are both correct OE. None of the abovearrow_forwardGive typing answer with explanation and conclusion Which description applies to alternative mRNA splicing? 1. heritable changes in gene expression that occur without altering the DNA sequence 2. processing of exons in mRNA that results in a single gene coding for multiple proteins 3. mRNA modifications such as additions of a 5′‑cap and 3′ poly‑A tail and removal of introns 4. a gene cluster controlled by a single promoter that transcribes to a single mRNA strand 5. protein modifications such as addition of a functional group or structural changes such as folding Answer 2 is correct.arrow_forward
- Which of the following terms refer to the case when a mutation results in a significant decrease or a complete loss of the functional activity of a gene product? a. gain-of-function mutation b. loss-of-function mutationarrow_forwardIf an MRNA is alternatively spliced, then different introns are removed from a pre-MRNA, producing transcripts that will potentially encode proteins with different primary structures. I. the MRNA is found in a bacterial cell. II. transcription and translation of the MRNA will occur simultaneously. the alternative splicing happened in the cytoplasm. IV. Ay different exons from a pre-mRNA will be spliced together. V. the different MRNAS will all have poly-A tails. VI.arrow_forwardFor a specific type of mutation at a given location in a particular gene, identify whether it will affect the size of the mRNA, the protein, or both. How would the mutant appear on a gel in comparison to the originalarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY