BIOLOGY:SCI.F/LIFE...-W/ACCESS >CUSTOM<
BIOLOGY:SCI.F/LIFE...-W/ACCESS >CUSTOM<
5th Edition
ISBN: 9781323448953
Author: BELK
Publisher: PEARSON C
Question
Book Icon
Chapter 9, Problem 1LTB
Summary Introduction

To write:

The nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Introduction:

A nucleotide is formed from three components “pentose sugar, a phosphate group, and nitrogenous bases”. Nucleic acids are complex molecules found in living organisms. They are formed from the interaction of many nucleotides. These are DNA and RNA. DNA stands for “deoxyribonucleic acid” and RNA stands for “ribonucleic acid”

Expert Solution & Answer
Check Mark

Explanation of Solution

The process of conversion of DNA into a form of RNA (mRNA) is termed as transcription. DNA and RNA contain the same type of nitrogenous bases. However, thymine is replaced by another nitrogenous base uracil (U) in RNA.

Therefore, the RNA transcript formed from DNA with sequence CGATTACTTA is GCUAAUGAAG.

Conclusion

GCUAAUGAAG is the nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Indicate the amino acids that would appear in the protein produced by translation of this mRNA sequence
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'
The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning