Concept explainers
Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence
What is the amino acid sequence of the polypeptideproduced from this sequence?
What term is used to identify a functional protein like this one formed when two identical polypeptides jointogether?
To analyze:
Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.
From this sequence, the amino acid sequence of the polypeptide produced is to be explained.
Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.
Introduction:
In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.
Transcription Translation
DNA → mRNA → polypeptide
The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.
Amino acid → polypeptide → Protein molecule
Explanation of Solution
The DNA template will undergo the following process to form the polypeptide chain:
3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template
↓ Transcription
5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA
↓ Translation
N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain
Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.
The amino acid sequence of a polypeptide chain is determined by the sequence of codons present on the DNA template strand.
The term “homodimer” is used when two identical polypeptide chains are bounded together.
Want to see more full solutions like this?
Chapter 9 Solutions
GENETIC ANALYSIS: INTEGRATED - ACCESS
- For the trinucleotide 5’ G-C-A-3’ How many nucleotide subunits are present in its ‘backbone’? How many nucleotide ‘non-backbone’ subunits are present? How many phosphodiester linkages are present? What is the overall charge carried by the trinucleotide?arrow_forwardThe diagram to the right illustrates the inter-actions of the amino acid side chains of two a-helical polypeptide strands in a coiled-coil, viewed end-on and projected along the helix axes from the N-terminal to the C-terminal end. Are the macrodipoles of the two a- helices oriented parallel or anti-parallel? For this projec- tion is the positive end of the macro-dipole in the sur- face of the paper or below the surface? f C b g e d a' a d' g b' f'arrow_forwardThe genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.arrow_forward
- To visualize the spatial arrangement of amino acid residues in an a-helix, it is helpful to imagine you are looking down the long axis of the helix, just as you would look down a soda straw. Viewed in this orientation, the residues form a circle, with each residue offset from its neighbor by 100 degrees. This representation is called a helical wheel. Use the circle below to indicate the position of each residue around the helix of the enzyme lysozyme. NH ...Arg - Cys - Glu- Leu - Ala Ala - Ala Met-Lys COO- The first two amino acids, Arg-1 and Cys-2, are shown as an example. Arg-1 O Glu-3 Which amino acid in the polypeptide is the first to pass the origin (i.e., which amino acid passes Arg- 1 first, completing one full circle)? Select the best answer. O Leu-4 O Ala-5 O Ala-6 O Ala-7 Met-8 O Lys-9 100° O none of the above Cys-2arrow_forwardSYNZIPS are a-helices that can be used in synthetic biology to create coiled-coil interactions between two different proteins. SYNZIP1 is around 47 amino acids in length. If each turn in an a-helix is 3.6 residues in length and each turn is 5.4 Å in length, how long is SYNZIP1? Keep in mind that 1 Å = 10 nm. Present your answer in nm.arrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forward
- Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…arrow_forwardGiven the following protein, which of the following sequences of TEMPLATE strand DNA would code for it? Pay attention to the polarity of the polypeptide and the strands of DNA that you choose. Use the codon chart to the right. AUG = met AAA = lys GCU = ala | CUU = leu ACU = thr -lys - thr - ala - leu - met (amino end) 5' TAC GAA CGA TGA TTT TAC ATT 3' 5' ATG CTT GCT ACT AAA ATG TAA 3' (carboxyl end) met 5' TAC TTT TGA CGA GAA TAC ATT 3¹' 3' TAC TTT TGA CGA GAA TAC ATT 5¹ 5' ATG AAA ACT GCT CTT ATG TAA 3¹ 3 TAC GAA CGA TGA TTT TAC ATT 5'arrow_forwardWhere would you expect a polypeptide region Ridge and the amino acid valine, leucine, and isoleucine to be located in a folded polypeptide? explainarrow_forward
- Shown below are two cartoon views of the small globular protein StrepG inwhich an α helix is packed against a four-strand β sheet. The sheet is madeup of two “β-hairpins” (a β-hairpin is a “β-turn-β” structure). Refer to theimages and answer the questions that follow: (a) Identify the locations of the N- and C-termini of StrepG.(b) Indicate the orientation of the helical macrodipole, showing the (δ+)and (δ-) ends of the macrodipole.(c) How many residues are in the helix?(d) Do you predict that the α helix and β sheet are amphiphilic or not?Briefly explain.(e) The following two peptides are part of the primary sequence of StrepG.Based on your answer to part (d), which one is more likely to correspondto the α helix? Which is most likely to be part of a β-hairpin? Explainyour choice.Peptide #1: DAATAEKVFKQYAND or Peptide #2: VDGEWTYDDATKTFTVarrow_forwardWithin a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are negatively charged (e.g., glutamateand aspartate), some are polar but uncharged, and some are nonpolar.If you knew that a DNA-binding protein was recognizingthe DNA backbone rather than a base sequence, which aminoacids in the protein would be good candidates for interacting withthe DNA?arrow_forwardImagine a globular protein with a histidine that is involved in a salt bridge to an aspartic acid, in an internal (hydrophobic) region of the protein. What would happen to the pKa of that histidine R group if the protein was mutated, and the aspartic acid was replaced with an alanine? (i.e., would the pKa increase, decrease, or stay the same?). Assume that the location of the histidine stays the same. Explain your answer clearlyarrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education