Concept explainers
Table
Use the data in this table to
Determine the consensus sequence for the
Compare the consensus sequence for these globin genes to the consensus sequence derived from the larger study of
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 9 Solutions
GENETIC ANALYSIS: INTEGRATED - ACCESS
- Determine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case "i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AĞG GAA TGC CTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC ССАarrow_forwardDetermine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case “i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AGG GAA TGC СTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC CCA Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC CAA This is the strand with the SNP. (The change is shown in red.) AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TAG TAT CGC TGG GCC САА Suppose a different single-nucleotide…arrow_forwardThe consensus sequence of the protospacer adjacent motif (PAM) sequence in bacterial strain A is 5'-NGG-3, whereas in bacterial strain B the consensus PAM sequence is 5'-NGRRN-3: Calculate the frequency at which each of these PAM sequences will occur in DNA using N = any nucleotide and R = purine base. Bacterial strain A: PAM sequence occurs once in every 16 nucleotides Bacterial strain B: PAM sequence occurs once in every 32 nucleotides Bacterial strain A: PAM sequence occurs once in every 32 nucleotides Bacterial strain B: PAM sequence occurs once in every 16 nucleotides Bacterial strain A: PAM sequence occurs once in every 32 nucleotides Bacterial strain B: PAM sequence occurs once in every 32 nucleotides Bacterial strain A: PAM sequence occurs once in every 16 nucleotides Bacterial strain B: PAM sequence occurs once in every 16 nucleotidesarrow_forward
- The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.arrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardBelow is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC GCCACTGATCATTA–3’arrow_forward
- For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also labeled, what are the first 3 nucleotides of the RNA transcribed from this sequence? +1 5.10 +10 3 GAGCGACATAATACGATTAT 5' AUA 3' 5' AAU 3' 5' UAU 3' 5' UUA 3' 5' CUA 3'arrow_forwardThe following DNA sequences found on the sense strand belong to the same eukaryotic gene: Sequence 1: 5'-GATTCAATAAAGCTCAGATCGCTCACGTCGCGACTC-3' Sequence 2: 5'-TCCGAGGTCACTAGATACTCGTCGATCGTATAAATG-3' a) Which sequence is likely to be found upstream from the coding sequence? Justify your answer. b) Which sequence is likely to be found downstream from the coding sequence? Justify your answer. c) Which sequence will not be transcribed into an mRNA transcript? Justify your answer.arrow_forwardBelow is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forward
- A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8 Given the location and type of the mutation, why would scientists potentially be concerned about this variant?arrow_forwardConsider the following original coding sequence of a gene that codes for a short 5- amino acid polypeptide: 5'-ATGGGCTCGAACTCATAA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U U A UUU UUC- UUA UUG- CUU CUC CUA CUG- U Phe (F) Leu (L) Leu (L) Second base in codon Val (V) UCU - UCC UCA UCG CCU CCC CCA CCG AUU ACU- AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU- GUC GCC GUA GCA GUG GCG- C Ser (S) Pro (P) Thr (T) Ala (A) UAU UAC UAAT UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG A Tyr (Y) STOP His (H) Gln (Q) Asn (N) Lys (K) Asp (D) Glu (E) G UGU UGC UGA STOP UGG Trp (W) Cys (C) CGU CGC CGA CGG AGU AGC AGA 1 AGG GGU- GGC GGA GGG Arg (R) Ser (S) Arg (R) Gly (G) U C A G U C A G U C A G U C A G Last base in codonarrow_forwardThree E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the same amino acid. What is the amino acid ?arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)